Method for constructing prokaryote single cell RNA sequencing library

A technology for prokaryotic and sequencing libraries, applied in the field of constructing prokaryotic single-cell RNA sequencing libraries, can solve the problems of complicated operation, unstable effect, complicated and time-consuming experimental operation, etc., and achieve the effect of reducing preference, high efficiency and easy operation

Pending Publication Date: 2022-07-29
BEIJING STOMATOLOGY HOSPITAL CAPITAL MEDICAL UNIV
View PDF15 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The cell barcode of this method collects cells four times and redistributes them into multi-well plates during the reverse transcription process, adding a small section of barcode each time, and making most cells have unique cell barcodes by combining multiple additions. The method is complicated to operate and the effect is unstable
At the same time, since random primers have multiple binding sites on one mRNA, the amount of cDNA obtained by reverse transcription of each mRNA is different, and the resulting bias will seriously affect the accuracy of RNA expression detection
And also because of random primers, this method cannot reduce PCR bias by labeling a single mRNA with molecular tags
In addition, SPLiT-seq technology needs to add cells and reaction solution to each well of the multi-well plate several times, and the experimental operation is complicated and time-consuming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing prokaryote single cell RNA sequencing library
  • Method for constructing prokaryote single cell RNA sequencing library
  • Method for constructing prokaryote single cell RNA sequencing library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1 L-type Escherichia coli single-cell RNA sequencing

[0064] 1. Cell fixation and permeabilization.

[0065] Resuspend 5000 or 20000 L-type E. coli cells in PBS containing 0.01% formaldehyde and 0.1% Tween20 and incubate at room temperature for 15 minutes. Centrifuge, then wash twice with PBS containing 1% BSA and once with PBS. Centrifuge to remove supernatant. Since L-type E. coli has no cell wall, there is no need for wall-breaking of prokaryotic cells here. Cells treated in this step still retain their single-cell environment, but the reagents and other reactants for the extended sequence reaction can pass freely.

[0066] 2. Connect the 3' end of bacterial RNA to extend the sequence.

[0067] 2.1 Add 20 μL of 3'-end linker ligation solution: 1×T4 RNA Ligase Buffer, 0.5 μM 3'-end RNA linker sequence (that is, the extended sequence of this example: 5'- / 5rApp / CTGTCTCTTATACACATCTGACGCTGCCGACGA / 3ddC / -3', 5rApp represents 5 '-phosphorylated ribonucleotide b...

Embodiment 2

[0094] Example 2 Sequencing and data analysis of the files obtained in Example 1

[0095] 1. Sequencing using the Illumina NextSeq platform. The read length was set as: read1: 80bp, i5 index: 16bp, i7 index: 8bp, read2: 80bp. . Among them, the sequencing data read by read2 is the mRNA partial sequence of the transcriptome, the sequencing data read by read1 is the reverse complementary sequence of the mRNA partial sequence of the transcriptome, the sequencing data read by i5 index is the cell tag, and the sequencing data read by i7 index is the cell label. The sequencing data for the library are split markers.

[0096] 2. Split the library through the sequencing data read by the i7 index, and classify the data of the sequencing data read by the i5 index into the cell to which the sequencing fragment belongs; the reverse complementary sequence of the data sequence read by read2 and the sequencing data read by read1 Align the reference genome of E. coli to confirm the correspo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a method for constructing a prokaryote single-cell RNA sequencing library. According to the method, an extension sequence can be added to mRNA under the condition that prokaryote cells are not cracked, prokaryote mRNA can be efficiently called by utilizing the extension sequence, different cell tags are marked for mRNA from different cell sources, and a low-preference prokaryote single cell mRNA sequencing library is obtained.

Description

technical field [0001] The invention relates to a method for constructing a prokaryotic single-cell RNA sequencing library, which belongs to the technical field of gene sequencing. Background technique [0002] With the improvement of gene sequencing technology and the successive development of major projects such as the Human Genome Project, the Cancer Genome Project, and the Meta-Hit Project, genome research and RNA sequencing have increasingly become powerful tools for biological and medical research. However, the sequencing material used to date for RNA sequencing has mostly been pooled RNA samples derived from millions or more of cells. The RNA sequence and quantitative information thus obtained can only represent the average situation of the population of cells, or the situation of the cells in which the number is dominant, ignoring the unique characteristics of individual cells. To solve this problem, single-cell sequencing technology came into being. Compared with ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6806C12Q1/6869C40B50/06C40B40/02
CPCC12Q1/6806C12Q1/6869C40B50/06C40B40/02C12Q2521/107C12Q2525/191C12Q2531/113C12Q2563/179C12Q2563/159C12Q2535/122
Inventor孙静华李小林
OwnerBEIJING STOMATOLOGY HOSPITAL CAPITAL MEDICAL UNIV