Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lentiviral vector for inhibiting expression of VSTM2L and application of lentiviral vector

A lentiviral vector and lentiviral technology, applied in the field of genetic engineering, can solve the problem of not inhibiting VSTM2L lentiviral vector

Active Publication Date: 2022-08-05
SHAANXI NORMAL UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] According to the data search conducted by the applicant, so far, in the existing gene editing technology, there is no relevant literature, technical patents and research reports on the lentiviral vector that inhibits the expression of VSTM2L in cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentiviral vector for inhibiting expression of VSTM2L and application of lentiviral vector
  • Lentiviral vector for inhibiting expression of VSTM2L and application of lentiviral vector
  • Lentiviral vector for inhibiting expression of VSTM2L and application of lentiviral vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Construction of VSTM2L gene shRNA lentiviral vector

[0034] (1) Design and synthesize shRNA

[0035] In this example, two shRNA nucleotide sequences targeting the CDS region of VSTM2L or the 3'UTR are designed, respectively:

[0036] VSTM2L-shRNA1:GCAGCAACATCTCCCACAAGC

[0037] VSTM2L-shRNA2: CAGCAACATCTCCCACAAGCT

[0038] After designing the shRNA nucleotide sequence, insert the shRNA nucleotide sequence according to the following structure to obtain two pairs of shRNA oligonucleotide sequences (sense is the shRNA sequence, and anti-sense is the complementary sequence):

[0039] Forward oligo: 5'CCGG-21bp sense-CTCGAG-21bp anti-sense-TTTTTG 3';

[0040] Reverse oligo: 5'AATTCAAAAAA-21bp sense-CTCGAG-21bp anti-sense 3';

[0041] After the design is completed, it will be synthesized by Shanghai Sangon Bioengineering Co., Ltd. The final shRNA oligonucleotide sequence targeting VSTM2L obtained is as follows:

[0042] VSTM2L-shRNA1:

[0043] Forward oligo: 5’-CCGGGCA...

Embodiment 2

[0051] Preparation of lentivirus targeting the VSTM2L gene

[0052] (1) HEK293T cell culture

[0053] HEK293T cells used in this example were purchased from the American Type Culture Collection (ATCC), and were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C, 5% CO 2 In the incubator, cells were passaged when they reached 90% confluency. The day before lentivirus packaging, HEK293T cells were trypsinized and then seeded into 6-well plates. After culturing for 24 hours, the cells were completely adherent and the cell density reached 60-70% before proceeding to the next step.

[0054] (2) Lentiviral packaging

[0055] Lentiviral packaging can be performed when HEK293T cells grow to 60-70%. The following operations only represent the dosage for one well of a six-well plate: Take two 1.5mL sterile centrifuge tubes, add 125μL opti-MEM to the first centrifuge tube to dilute the lentiviral packaging plasmids pMD2.G (375ng), psPAX2 (1125ng) and pLKO....

Embodiment 3

[0057] Construction and identification of a lentiviral vector cell line that effectively inhibits the expression of VSTM2L

[0058] (1) Culture of prostate cancer cells

[0059] Prostate cancer cell line 22Rv1 was purchased from the American Type Culture Collection (ATCC), and was cultured in complete RPMI-1640 medium containing 10% fetal bovine serum and 1% double antibody at 37°C, 5% CO 2 In the incubator, cells can be passaged when they reach 90% confluency.

[0060] (2) Construction of 22Rv1 cell line that effectively inhibits the expression of VSTM2L

[0061] First, the 22Rv1 cell line in the logarithmic growth phase was digested with trypsin for 5 min, and after the digestion was neutralized with 2 times the volume of trypsin, the digested cells were carefully blown off and collected into a 15 mL centrifuge tube at 800×rpm. , centrifuge for 3 min, discard the supernatant, collect the cells at the bottom of the centrifuge tube; then, add 1 mL of RPMI-1640 complete mediu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lentiviral vector for inhibiting expression of VSTM2L and a preparation method of the lentiviral vector, the lentiviral vector contains two shRNA (short hairpin ribonucleic acid) nucleotide sequences, and the two shRNA nucleotide sequences are VSTM2L-shRNA1: GCAGCAACATTCCCACAAGCVSTM2L-shRNA2: CAGCAACATTCCCACAAGCT respectively. The lentiviral vector is obtained by inserting an shRNA (short hairpin Ribonucleic Acid) nucleotide sequence for inhibiting VSTM2L expression into a lentiviral vector pLKO.1. Or the lentivirus vector and lentivirus packaging plasmids pMD2. G and psPAX2 are used for co-transfecting HEK293T cells through a liposome Lipofectamine 2000TM, so that the lentivirus capable of specifically inhibiting the expression of the VSTM2L is obtained. Experiments show that the shRNA or the lentiviral vector or the lentivirus can effectively and stably inhibit expression of the VSTM2L in human prostate cancer cells, and can be applied to preparation of drugs for inhibiting proliferation, migration and clone formation ability of the human prostate cancer cells. Meanwhile, the method can also be applied to research on the action and mechanism of the VSTM2L gene in occurrence and development of human prostatic cancer.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a lentiviral vector for inhibiting the expression of VSTM2L and its application. Background technique [0002] Prostate cancer is one of the most common male malignancies worldwide. Among prostate cancer patients, early-stage patients have a higher cure rate, while middle-advanced patients have a low cure rate and poor prognosis. The pathogenesis of prostate cancer is complex, so finding its prognostic molecular targets is crucial for improving the prognosis of prostate cancer patients. [0003] According to the data search conducted by the applicant, up to now, in the existing gene editing technology, there are no relevant literatures, technical patents and research reports on lentiviral vectors that inhibit the expression of VSTM2L in cancer cells. SUMMARY OF THE INVENTION [0004] The purpose of the present invention is to provide a lentiviral vector for inhibiti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/867C12N15/66C12N7/01A61K48/00A61K31/7088A61P35/00A61P35/04C12R1/93
CPCC12N15/1135C12N15/86C12N15/66C12N7/00A61K48/005A61K48/0008A61K31/7088A61P35/00A61P35/04C12N2310/14C12N2320/32C12N2740/15021C12N2740/15043Y02A50/30
Inventor 高平杨娟董小明李琪
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com