Recombined glucokinase
A staphylokinase and coding technology, applied in the biological field, can solve the problems of low level of natural Sak secretion, restricting the development of Sak, backward purification process, etc., and achieve the effects of small molecular weight, fast thrombolysis speed and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] 1. Primer design:
[0041] According to the known nucleotide sequence of staphylokinase, a pair of primers are designed, and the fragment of staphylokinase gene amplified by the primers is the fragment of staphylokinase gene with 15 amino acid residues missing before the mature staphylokinase gene.
[0042] Primer I: 5'CACGAATTCATGAAGGGCGATGACGCGAGT;
[0043] Primer II: 5'CACGGATCCTATTTTCTTTCAATAACAAC.
[0044] 2. PCR reaction:
[0045] dd.H 2 O 31 μl
[0046] 10xPCR buffer 5μl
[0047] dNTP (2.0mmol) 4μl
[0048] P-1 (20pmol) 2μl
[0049] P-2 (20pmol) 2μl
[0050] Template DNA (Sak136DNA) 5μl
[0051] Pfu DNA polymerase (2.0u / μl) 1μl
[0052] Shake, centrifuge slightly, and denature at 92°C for 3 minutes. Put it into the PCR amplification instrument and carry out the reaction according to the following steps:
[0053] 94°C for 10 seconds
[0054] 55°C 30 seconds
[0055] 30 cycles of 60 seconds at 72°C, followed by an extension at 72°C for 10 minutes. Tak...
Embodiment 2
[0062] Separation and Purification of a Recombinant Staphylokinase (121) Product
[0063] 1. Harvest:
[0064] The fermentation broth was centrifuged at 10,000 rpm for 10 minutes at 4°C to collect the bacterial cells. Suspend in 20mM phosphate buffer (pH8.0), wash the bacteria once, centrifuge under the same conditions, and collect the bacteria.
[0065] 2. High pressure melting slurry:
[0066] The cells were collected by centrifugation, 1000ml of 20mM phosphate (pH8.0) buffer was added to 1000ml of wet weight cells to suspend, and the cells were broken with a high-pressure lyser, centrifuged at 15,000rpm at 4°C for 20 minutes, and the supernatant was collected. Using SDS-PAGE to detect the above cell lysate, it can be seen that there is a very thick zone at the molecular weight of 14KD, and the content is about 45% through scanning analysis. It can be seen that the expression product is soluble.
[0067] 3. Ultrafiltration:
[0068] The supernatant is collected by high-p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
