Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombined glucokinase

A staphylokinase and coding technology, applied in the biological field, can solve the problems of low level of natural Sak secretion, restricting the development of Sak, backward purification process, etc., and achieve the effects of small molecular weight, fast thrombolysis speed and strong specificity

Inactive Publication Date: 2004-07-14
YONGAN SHIJI SOFTWARE TECH DEV BEIJING
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 1948, Lack C.H first discovered that it has the ability to dissolve thrombus. Due to the low level of natural Sak secretion and the backward purification process at that time, the development of Sak was restricted.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined glucokinase
  • Recombined glucokinase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] 1. Primer design:

[0041] According to the known nucleotide sequence of staphylokinase, a pair of primers are designed, and the fragment of staphylokinase gene amplified by the primers is the fragment of staphylokinase gene with 15 amino acid residues missing before the mature staphylokinase gene.

[0042] Primer I: 5'CACGAATTCATGAAGGGCGATGACGCGAGT;

[0043] Primer II: 5'CACGGATCCTATTTTCTTTCAATAACAAC.

[0044] 2. PCR reaction:

[0045] dd.H 2 O 31 μl

[0046] 10xPCR buffer 5μl

[0047] dNTP (2.0mmol) 4μl

[0048] P-1 (20pmol) 2μl

[0049] P-2 (20pmol) 2μl

[0050] Template DNA (Sak136DNA) 5μl

[0051] Pfu DNA polymerase (2.0u / μl) 1μl

[0052] Shake, centrifuge slightly, and denature at 92°C for 3 minutes. Put it into the PCR amplification instrument and carry out the reaction according to the following steps:

[0053] 94°C for 10 seconds

[0054] 55°C 30 seconds

[0055] 30 cycles of 60 seconds at 72°C, followed by an extension at 72°C for 10 minutes. Tak...

Embodiment 2

[0062] Separation and Purification of a Recombinant Staphylokinase (121) Product

[0063] 1. Harvest:

[0064] The fermentation broth was centrifuged at 10,000 rpm for 10 minutes at 4°C to collect the bacterial cells. Suspend in 20mM phosphate buffer (pH8.0), wash the bacteria once, centrifuge under the same conditions, and collect the bacteria.

[0065] 2. High pressure melting slurry:

[0066] The cells were collected by centrifugation, 1000ml of 20mM phosphate (pH8.0) buffer was added to 1000ml of wet weight cells to suspend, and the cells were broken with a high-pressure lyser, centrifuged at 15,000rpm at 4°C for 20 minutes, and the supernatant was collected. Using SDS-PAGE to detect the above cell lysate, it can be seen that there is a very thick zone at the molecular weight of 14KD, and the content is about 45% through scanning analysis. It can be seen that the expression product is soluble.

[0067] 3. Ultrafiltration:

[0068] The supernatant is collected by high-p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the construction of recombinant glucokinase (Sak) and the preparation process of the expression product, and belongs to the field of biotechnology. The Sak of the present invention is Sak derivative with 15 deletion amino acid residues in the N end and comprising 121 amino acids. The modified Sak gene is expressed effectively in colibacillus with expression level 10 % higher than mature glucokinase expression amount and specific activity about 20 % higher than that of mature glucokinase. The separated and purified single component Sak product has expression product with small molecular weight, high specificity and fast thrombolytic speed. The present invention is suitable for industrial production and may be used in prevention and treatment of acute myocardial infarction, cerebral thrombus and other acute thrombotic diseases.

Description

technical field [0001] The invention relates to the construction of a staphylokinase mutant strain (121) for dissolving thrombus and a method for separating and purifying its expression product, belonging to the field of biotechnology. Background technique [0002] Staphylokinase (Sak) is a protein secreted from Staphylococcus aureus. In 1948, Lack C.H first discovered that it has the ability to dissolve thrombus. Due to the low secretion level of natural Sak and the backward purification process at that time, the development of Sak was restricted. In the 1980s, with the development of genetic engineering technology, the nucleotide sequence of Sak was analyzed and its thrombolytic mechanism was confirmed. Like streptokinase (SK), Sak first combines with plasminogen to form a complex to catalyze the conversion of plasminogen into plasmin, and then hydrolyzes fibrin. Sak preferentially binds to the plasminogen on the thrombus and hydrolyzes the fibrin in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/48A61P9/00C12N9/50C12N15/57C12N15/70
Inventor 杜永峰左新文
Owner YONGAN SHIJI SOFTWARE TECH DEV BEIJING
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com