Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Angiotensin II-2 type receptor gene and its correlation of essential hypertension

A high blood pressure and gene technology, applied in the fields of molecular biology and medicine, can solve the problems of unproven R gene and essential hypertension, etc.

Inactive Publication Date: 2005-05-11
SHANGHAI INST OF HYPERTENSION +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there have been many studies on RAS system polymorphisms and essential hypertension, there is no confirmed AT 2 Reports on the correlation between R gene and essential hypertension, not to mention AT 2 A report on the relationship between SNP of R gene and essential hypertension

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Angiotensin II-2 type receptor gene and its correlation of essential hypertension

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] 1 Objects and methods

[0074] 1.1 Research object

[0075] 1.1.1 Chinese SNP discovery and confirmation samples

[0076] The samples were 19 unrelated essential hypertension patients from 19 core Han hypertensive families.

[0077] 1.1.2 Preliminary research samples of SNP typing and association analysis

[0078] All subjects were of Han nationality. The essential hypertension group (EH group) and the normotensive group (NT group) had 96 cases each, both from Shanghai, China, and had no relationship with each other. The EH group consisted of hypertensive patients who were diagnosed in the Hypertension Department of Shanghai Ruijin Hospital or in the general survey in Shanghai, including 46 males and 50 females, with an average age of 49.7±7.13 years old. The inclusion criteria were: (1) systolic blood pressure > 150mmHg and / or diastolic blood pressure > 95mmHg (i.e. excluding patients with borderline hypertension), or receiving antihypertensive drug therapy for mor...

Embodiment 2

[0130] Essential Hypertension Susceptibility Detection Kit

[0131] A kit is prepared which contains:

[0132] Name Sequence (5’→3’) Number Concentration

[0133] Forward primer gcacatttgtggaaacttcattt SEQ ID NO: 7 dry powder 2OD

[0134] Reverse primer ctggttgttgaagtttaaagcag SEQ ID NO: 8 dry powder 2OD

[0135] PCR reaction solution containing Taq enzyme dNTP magnesium ion PCR reaction buffer

[0136] Take 3ml of blood from the male patient to be tested, and use a conventional method (or use a specific kit) to extract DNA from the blood. Dilute the PCR primers in the hypertension detection kit to 1 μmol / μl, and use the extracted DNA as a template to carry out PCR reaction with the provided primers. After purification of PCR products, ABI-PRISM TM 377 DNA sequencer was used for two-way sequencing by fluorescence-labeled terminal termination method, and Polyphred software was used for sequence interpretation and SNP confirmation.

[0137] Test results figure 1 As shown...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Total lengthaaaaaaaaaa
Login to View More

Abstract

The invention was involved in a method to detect primary hypertension susceptibility. The method contained two steps,namely assaying acceptor gene AT2R of individual angiotensin II2 and analysing variation between the protein and the normal protein. The variation showed that the individual had more chance to get primary hypertension than normal people. The invention provided corresponding detection kit.

Description

technical field [0001] The present invention relates to the fields of molecular biology and medicine. More specifically relate to human angiotensin II type 2 receptor gene (Angiotensin II type 2 receptor gene, AT 2 R) single nucleotide polymorphism (singlenucleotide polymorphism, SNP) and its correlation with essential hypertension. The present invention also relates to methods and kits for detecting these SNPs. Background technique [0002] Essential hypertension (essential hypertension, EH) is the most common cardiovascular disease, its incidence rate is increasing year by year, and can cause serious heart, brain, kidney complications, and is a major risk factor for stroke and coronary heart disease. EH is a polygenic disease caused by the interaction of genetic factors and environmental factors. Finding EH-related genes and then clarifying the genetic mechanism of hypertension has become a research hotspot (Harrap SB. Hypertension: genes versus environment. Lancet, 1994...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 张怡朱鼎良张奎星王谷亮黄薇
Owner SHANGHAI INST OF HYPERTENSION
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More