Angiotensin II-2 type receptor gene and its correlation of essential hypertension
A high blood pressure and gene technology, applied in the fields of molecular biology and medicine, can solve the problems of unproven R gene and essential hypertension, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] 1 Objects and methods
[0074] 1.1 Research object
[0075] 1.1.1 Chinese SNP discovery and confirmation samples
[0076] The samples were 19 unrelated essential hypertension patients from 19 core Han hypertensive families.
[0077] 1.1.2 Preliminary research samples of SNP typing and association analysis
[0078] All subjects were of Han nationality. The essential hypertension group (EH group) and the normotensive group (NT group) had 96 cases each, both from Shanghai, China, and had no relationship with each other. The EH group consisted of hypertensive patients who were diagnosed in the Hypertension Department of Shanghai Ruijin Hospital or in the general survey in Shanghai, including 46 males and 50 females, with an average age of 49.7±7.13 years old. The inclusion criteria were: (1) systolic blood pressure > 150mmHg and / or diastolic blood pressure > 95mmHg (i.e. excluding patients with borderline hypertension), or receiving antihypertensive drug therapy for mor...
Embodiment 2
[0130] Essential Hypertension Susceptibility Detection Kit
[0131] A kit is prepared which contains:
[0132] Name Sequence (5’→3’) Number Concentration
[0133] Forward primer gcacatttgtggaaacttcattt SEQ ID NO: 7 dry powder 2OD
[0134] Reverse primer ctggttgttgaagtttaaagcag SEQ ID NO: 8 dry powder 2OD
[0135] PCR reaction solution containing Taq enzyme dNTP magnesium ion PCR reaction buffer
[0136] Take 3ml of blood from the male patient to be tested, and use a conventional method (or use a specific kit) to extract DNA from the blood. Dilute the PCR primers in the hypertension detection kit to 1 μmol / μl, and use the extracted DNA as a template to carry out PCR reaction with the provided primers. After purification of PCR products, ABI-PRISM TM 377 DNA sequencer was used for two-way sequencing by fluorescence-labeled terminal termination method, and Polyphred software was used for sequence interpretation and SNP confirmation.
[0137] Test results figure 1 As shown...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Total length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
