Gene engineering bacteria of high efficiency expression of human alpha 1-thymulin and its construction method and use

A technology of genetically engineered bacteria and high-efficiency expression, applied in genetic engineering, medical preparations containing active ingredients, applications, etc., to achieve low production costs, simple purification steps, and increased expression

Inactive Publication Date: 2005-05-18
EAST CHINA NORMAL UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To treat these patients, relying entirely on imported human α1-thymosin drugs will bring heavy economic losses and mental burdens to the country and individuals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene engineering bacteria of high efficiency expression of human alpha 1-thymulin and its construction method and use
  • Gene engineering bacteria of high efficiency expression of human alpha 1-thymulin and its construction method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Construction of a genetically engineered bacterium that highly expresses human α1-thymosin: it contains 1-16 SD-His·Tag-EK-Tα 1 -Genetically engineered bacteria of TAA tandem units. The following pET32a(+) plasmid was purchased from Novagen.

[0039] The first step base sequence synthesis

[0040] According to the amino acid sequence of human α1-thymosin, the Escherichia coli preferred codon was selected to synthesize the following 206bp fragment:

[0041] XbaI SD-Sequence

[0042] 5'-CC tctaga AATAATTTTGTTTAACTTTAAG AAGGAGA TATACATATGTCTGGA

[0043] Met Ser Gly

[0044] His Tag KpnI

[0045] TCAGGT CATCATCATCATCATCAT TCTTCT ggtacc GATGACGACGACAAG

[0046] Ser Gly His His His His His His His Ser Ser Gly Thr Asp Asp Asp Asp Lys

[0047] EK

[0048] AGCGATGCCGCCGTGGATACCAGCAGCGAAATTACCACCAAAGATCTGAAA

[0049] Ser AspAla Ala V...

Embodiment 2

[0058] Example 2 Construction of a genetically engineered bacterium that highly expresses human α1-thymosin: Contains 1-16 P-SD-His·Tag-EK-Tα 1 -Genetically engineered bacteria of TAA tandem units. The P is a promoter (Promotor, P).

[0059] The first step base sequence synthesis

[0060] With embodiment 1.

[0061] The second step is to construct a single P-SD-His·Tag-EK-Tα 1 -Genetically engineered bacteria with TAA DNA sequence

[0062] Extract the pMD18-T plasmid, purify and recover small fragments after double digestion with XbaI / EcoRI; meanwhile, digest plasmid pET-32a(+) with XbaI / EcoRI double digestion, and recover large fragments. The recovered product was ligated and transformed into Escherichia coli DH5α for amplification. A single string of P-SD-His·Tag-EK-Tα was obtained 1 - Plasmid pET-32a-Tα for the TAA gene 1 -1c (1c represents the fusion gene monomer, 2c represents the fusion gene double body, and so on).

[0063] The third step is to construct multipl...

Embodiment 3

[0066] Example 3 Construction of a genetically engineered bacterium that highly expresses human α1-thymosin: containing 1-16 SD-TrxA-His·Tag-EK-Tα 1 -Genetically engineered bacteria of TAA tandem units. The TrxA is thioredoxin.

[0067] The first step base sequence synthesis

[0068] With embodiment 1.

[0069] The second step is to construct a single SD-TrxA-His·Tag-EK-Tα 1 -Genetically engineered bacteria with TAA DNA sequence

[0070] The pMD18-T plasmid was extracted, and the small fragment was purified and recovered after double digestion with KpnI / EcoRI; at the same time, the large fragment was recovered by double digestion of the plasmid pET-32a(+) with KpnI / EcoRI. The recovered product was ligated and transformed into Escherichia coli DH5α for amplification. Since the plasmid pET-32a(+) is a thioredoxin fusion protein expression system, a single string of SD-TrxA-His·Tag-EK-Tα can be obtained 1 - Plasmid pET-32a-TrxA-Tα for the TAA gene 1 -1c (1c represents the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is gene engineering bacteria with high efficiency expression of human alpha 1-thmulin and its construction and application, and belongs to the field of bioengineering technology. The gene engineering bacteria is colibacillus DH5-alpha, BL21(DE3) or BLR(DE3), and carry plasmid containing 1-16 alpha 1-thmulin genes. The plasmid promoter is IPTG induced promoter Lac, Tac of PT7, such as plasmid pET series, pGEX series, pQE series, etc. On DNA level, DNA sequences containing alpha 1-thmulin gene are connected serially to form serial body and constitute one series of expression vectors, which transform colibaccilus to obtain one series of gene engineering bacteria with high efficiency expression of human alpha 1-thmulin. The gene engineering bacteria may be used in preparing human alpha 1-thmulin samples. The present invention has high yield and low cost of human alpha 1-thmulin samples.

Description

technical field [0001] The invention relates to a genetically engineered bacterium for highly expressing human α1-thymosin and its construction method and application, belonging to the technical field of bioengineering. Background technique [0002] Human α1-thymosin (Tα1) mainly exists in thymocytes, T-lymphocytes and thymus tissue in vivo, and is also distributed in liver, kidney, heart, lung, spleen and other organs. Mature human α1-thymosin consists of 28 amino acids, molecular weight 3.108KD, its sequence is: Ser-Asp-Ala-Ala-Val-Asp-Thr-Ser-Ser-Glu-ILe-Thr-Thr-Lys-Asp- Leu-Lys-Glu-Lys-lys-Glu-Val-Val-Glu-Glu-Ala-Glu-Asn. In vivo, the precursor α1-prothymosin (prothymosin) composed of 111 amino acids is produced by enzymatic processing. The normal concentration of human α1-thymosin in human serum is about 540-670pg / mL, and its main physiological function is to regulate the immune activity of the body, including stimulating the differentiation o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K38/17A61K38/32C12N1/21C12N15/12C12N15/16C12N15/63C12N15/70C12N15/72C12P21/02
Inventor徐伟东黄静吴自荣邹竹荣金明飞金丽王嘉
OwnerEAST CHINA NORMAL UNIV