Recombinant human parathormone PTH1-34 preparation method

A technology of parathyroid hormone and enterokinase enzyme, which is applied in the fields of parathyroid hormone, hormone peptide, recombinant DNA technology, etc., can solve the problems of unsatisfactory expression purity and physiological activity, etc.

Active Publication Date: 2006-07-26
SHANGHAI CELGEN BIO PHARMA CO LTD
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, the existing production processes are not satisfactory in terms of expression purity and physiological activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human parathormone PTH1-34 preparation method
  • Recombinant human parathormone PTH1-34 preparation method
  • Recombinant human parathormone PTH1-34 preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Construction of Trx-PTH1-34 expression vector and host cell

[0071] See Figure 1 for the preparation process.

[0072] (a) Preparation of PTH1-34

[0073] Two primers were designed and synthesized, corresponding to PTH 1-8 amino acid residues and 29-34 amino acid residues, respectively, for PCR cloning of human PTH 1-34 cDNA. The primer sequences are as follows:

[0074] 5' primer:

[0075] 5′ATCTG GGTACCGACGACGACGACAAG TCTGTGAGTGAAATACAGCTTAT 3' (SEQ ID NO: 5)

[0076] 3' Primer:

[0077] 5'TTATCAAAAATTGTGCACATCCTGC 3' (SEQ ID NO: 6)

[0078] The 5' primer contains the enterokinase cleavage point DDDDK and the N-terminal gene sequence of PTH (1-34), and introduces the KpnI cleavage point; the 3' primer contains the C-terminal gene sequence of PTH (1-34) and a stop codon. Using the above primers, PCR was carried out using conventionally prepared human parathyroid hormone cDNA as a template. Then PCR2.1-TOPO cloning kit of Invitrogen Company was used to directly...

Embodiment 2

[0084] Expression of Trx-PTH1-34

[0085] Pick the positive Escherichia coli B21(DE3) / Trx-PTH1-34 on the transformation plate, streak it on the agar plate of LB+1% glucose containing 100 μg / ml Amp, cultivate it at 37°C for 16 hours, and pick the single cells with good growth The colonies were inoculated in LB + 1% glucose culture solution (containing Amp 100 μg / ml) at 37° C., 270 rpm, and cultured overnight. The overnight bacteria were inoculated at 1:50 in LB+1% glucose culture solution (containing Amp 100 μg / ml), and cultured with shaking at 37°C. When OD 600 When it reaches 0.6-0.8, add IPTG to the final concentration of 1mM, and induce for 3 hours. The bacterial solution was centrifuged at 4000rpm for 10 minutes to remove the supernatant, the precipitated bacterial cells were added to the sample buffer, and the bacteria were broken in a water bath at 100°C for 5 minutes. After centrifugation, the soluble protein supernatant was subjected to SDS-PAGE electrophoresis (5% s...

Embodiment 3

[0089] Separation and purification of fusion protein and PTH1-34

[0090] (a) Separation and purification of fusion protein

[0091] After the fermentation of the engineered bacteria, the bacterial suspension was ultrasonically treated in an ice bath. After breaking the bacteria, it was centrifuged at 4°C and 9000rpm for 20min, and the Trx-EK-PTH fusion protein was mainly in the supernatant.

[0092] Purification by metal chelate column chromatography affinity column chromatography was performed as follows: 60 mM imidazole, 500 mM NaCl, pH 8.0, 20 mM PB loading buffer equilibrated for 3 column volumes. After the ultrasonic supernatant was filtered on a 0.45 μm membrane column, it was equilibrated with 60 mM imidazole, 500 mM NaCl, pH 8.0, and 20 mM PB buffer until the baseline was stable, and some impurities were removed. The fusion protein was eluted with 160mM imidazole, 500mM NaCl, pH8.0, 20mM PB buffer, and the peak of the fusion protein was collected and detected by SDS-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Specific activityaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides the method of merged protein which contains recombined human parathormone, coding the merged protein's DNA sequence, the carrier which contains the DNA sequence, the host cell which contains the carrier, using genetic engineering to prepare the merged protein and then produce PTH1-34. Enzyme cutting the merged protein by enterokinase can produce the recombined human parathormone PTH (1-34) has high physiologically active. The expression product is high, purity technology is simple and the cost is depressed, it can be used to the production of recombined human parathormone in force.

Description

technical field [0001] The invention relates to a method for preparing a fusion protein containing human parathyroid hormone PTH1-34 (abbreviated as "Trx-PTH1-34 fusion protein") by genetic engineering and then producing PTH1-34. The invention also discloses the DNA sequence encoding the fusion protein, the recombinant expression vector containing the sequence, the Escherichia coli recombinant expression strain, and the preparation method and application of the fusion protein. Background technique [0002] Human parathyroid hormone (PTH) is a single-chain polypeptide chain hormone synthesized and secreted by the principal cells of the human parathyroid gland. The initial synthesis is preproparathyroid hormone containing 115 amino acids, which is removed in the rough endoplasmic reticulum Proparathyroid hormone is formed after the N-terminal 25 amino acid residues. Proparathyroid hormone removes a hexapeptide from the N-terminal in the Golgi complex to form parathyroid hormo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/63C07K14/635
Inventor丁邦黎军
OwnerSHANGHAI CELGEN BIO PHARMA CO LTD