Relativity of glycerotriphosphate dehydrogenase gene with primary hypertension
A high blood pressure and gene technology, applied in the fields of molecular biology and medicine, can solve the problems of unconfirmed correlation between SNP and essential hypertension, unconfirmed, unconfirmed correlation between GPD2 gene and essential hypertension, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] 1 Objects and methods
[0058] 1.1 Research object
[0059] 1.1.1 Chinese SNP discovery and confirmation samples
[0060] The sample is 24 primary hypertension patients from 24 core Han nationality hypertensive families who are unrelated.
[0061] 1.1.2 SNP typing and association analysis research sample
[0062] All subjects are of Han nationality. There were 300 patients in the essential hypertension group (EH group) and the normal blood pressure group (NT group), both from Shanghai, China, and they were not related to each other. The EH group were inpatients in the Hypertension Department of Shanghai Ruijin Hospital, all of whom were of Han nationality and were not related. The average age is 57.32±11.75 years. standard constrain:
[0063] The systolic blood pressure is 140mmHg and / or the diastolic blood pressure is 90mmHg, or they are receiving antihypertensive drug treatment for at least one year;
[0064] Except for those with onset before or after the age of 60;
[0...
Embodiment 2
[0097] Susceptibility auxiliary detection kit for essential hypertension
[0098] Prepare a kit containing:
[0099] PCR reaction buffer containing Taq enzyme dNTP magnesium ion PCR reaction buffer
[0100] Name Sequence (5’→3’) Number Concentration
[0101] Forward primer gtagatgcctggctgagaatg SEQ ID NO: 22 Dry powder 20D
[0102] Reverse primer gcgtggcataaatgaaagaga SEQ ID NO: 23 dry powder 20D
[0103] PCR reaction buffer containing Taq enzyme dNTP magnesium ion PCR reaction buffer
[0104] Take 3ml of blood from the male patient to be tested, and use conventional methods (or use a specific kit) to extract DNA from the blood. The PCR primers in the hypertension detection kit are diluted to 1μmol / μl, and the extracted DNA is used as a template to perform a PCR reaction with the provided primers. After the PCR product is purified, use ABI-PRISM TM 377 DNA sequencer performs two-way sequencing with fluorescent labeling terminal termination method, and uses Polyphred software for s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 