Preparation of human plasma protein fused long-effective interferon

A technology of human serum albumin and interferon, which is applied in the field of preparation of recombinant human serum albumin fused with long-acting interferon, can solve the problems of lack of literature and data on the influence of immunogenicity and therapeutic effect.

Active Publication Date: 2007-01-17
NOVOPROTEIN SCI INC
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The fusion protein contains foreign protein sequences, and there is still a lack of literature on the impact of the presence of foreign protein sequences on its immunogenicity and therapeutic effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation of human plasma protein fused long-effective interferon
  • Preparation of human plasma protein fused long-effective interferon
  • Preparation of human plasma protein fused long-effective interferon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] The present invention relates to a preparation method of fusion protein of human serum albumin and human interferon protein, the method at least includes the following steps:

[0025] (a) Cloning and codon optimization of human serum albumin gene;

[0026] (b) Human interferon alpha2b gene cloning and codon optimization;

[0027] (c) construction of human serum albumin gene and human interferon alpha2b gene connection and expression plasmid;

[0028] (d) Electrotransformation of Pichia pastoris and expression strain screening;

[0029] (e) fermentation culture; and,

[0030] (f) Fusion protein purification.

[0031] Wherein, in step (a), HSA cDNA is obtained from human fetal liver cDNA library by PCR method. In addition to including the 5' end sequence of the HSA gene, ALBF also added a Kex2 restriction signal recognition sequence (underlined part) before its 5' end:

[0032] ALBF: 5' AAAAGA GATGCACACAAGAGTGAGGTTGC3'

[0033] ALBB: 5'TAAGCCTAAGGCAGCTTGACTTGC3'

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A human hemocyanin fused long-acting interferon protein, DNA sequence of its coded fused protein and its production are disclosed. It has better interferon biological activity and longer interferon half-life.

Description

technical field [0001] The invention relates to the preparation of recombinant human serum albumin fusion long-acting interferon. The interferon produced by the preparation method can obviously prolong the action time of the interferon in the body and can be used for the treatment of human related diseases. Background technique [0002] Human serum albumin (HSA) is a soluble monomeric protein that constitutes half of the total protein in blood. As a basic carrier, albumin carries molecules such as fatty acids, steroids and hormones, and its stable and inert nature is an important factor in maintaining blood pressure. Human serum albumin is a globular non-glycosylated protein with a molecular weight of 65Kd. The human serum albumin gene is located on chromosome 4, has 16961 base pairs, and is divided into 15 spacers. The mRNA formed after RNA processing and splicing can encode a protein with 585 amino acids. This protein undergoes transformation and processing by the Golgi ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K14/765C07K14/555C12N15/09C12P21/00
Inventor蔡丽君朱化星王英明毛佳
OwnerNOVOPROTEIN SCI INC