Gastrointestinal proliferative factor and uses thereof

a proliferative factor and gastrointestinal technology, applied in the field of gastrointestinal proliferative factor, can solve the problems of direct and indirect toxicity mucositis is the inflammation of the mucous membrane, and injury to the oral and gastrointestinal mucosa

Inactive Publication Date: 2005-11-17
NUVELO INC +1
View PDF5 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The present invention is based on the discovery of a gastrointestinal proliferative factor (GIPF) that induces the proliferation of epithelial cells in the gastrointestinal tract. This factor can be used to treat conditions where epithelial cell proliferation is needed, such as gastrointestinal disorders, inflammatory bowel disease, and wounds. The invention includes a therapeutically effective amount of a GIPF polypeptide and pharmaceutical compositions containing it. The invention also provides isolated polynucleotides that encode GIPF polypeptides and vectors for their use in genetic engineering. Overall, the invention provides a novel way to treat gastrointestinal disorders and promote epithelial cell regeneration."

Problems solved by technology

Ionizing radiation therapy and cytotoxic chemotherapy produce injuries to the oral and gastrointestinal mucosa, which remain significant problems for patients undergoing antineoplastic treatments.
Mucositis is the inflammation of the mucous membranes and is a particularly common problem in this patient population due to the use of chemotherapy and radiation therapy used with curative or palliative intent.
Chemotherapy and radiation therapy cause injury to the oral and gastrointestinal mucosa through direct and indirect toxicity.
These painful lesions also produce an increased risk for local and systemic infection.
The severity of these effects may preclude dose escalation, delay treatment, and warrant dose reductions, thus limiting the effectiveness of cancer therapy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gastrointestinal proliferative factor and uses thereof
  • Gastrointestinal proliferative factor and uses thereof
  • Gastrointestinal proliferative factor and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Isolation of SEQ ID NO: 1 from a Human cDNA Library

[0423] The novel nucleic acid of SEQ ID NO: 1 was obtained from a human cDNA library prepared from fetal skin (Invitrogen), using standard PCR, sequencing by hybridization sequence signature analysis, and Sanger sequencing techniques. The inserts of the library were amplified with PCR using primers specific for vector sequences flanking the inserts. These samples were spotted onto nylon membranes and interrogated with oligonucleotide probes to give sequence signatures. The clones were clustered into groups of similar or identical sequences, and a single representative clone was selected from each group for gel sequencing. The 5′ sequence of the amplified insert was then deduced using the reverse M13 sequencing primer in a typical Sanger sequencing protocol. PCR products were purified and subjected to fluorescent dye terminator cycle sequencing. Single-pass gel sequencing was done using a 377 Applied Biosystems (ABI) sequencer. The ...

example 2

Assemblage of SEQ ID NO: 2

[0424] The nucleic acid (SEQ ID NO: 2) of the invention was assembled from sequences that were obtained from a cDNA library by methods described in Example 1 above, and in some cases obtained from one or more public databases. The final sequence was assembled using the EST sequences as seed. Then a recursive algorithm was used to extend the seed into an extended assemblage, by pulling additional sequences from different databases (i.e. Nuvelo's database containing EST sequences, dbEST version 124, gbpri 124, and UniGene version 124) that belong to this assemblage. The algorithm terminated when there were no additional sequences from the above databases that would extend the assemblage. Inclusion of component sequences into the assemblage was based on a BLASTN hit to the extending assemblage with BLAST score greater than 300 and percent identity greater than 95%.

[0425] Using PHRAP (Univ. of Washington) or CAP4 (Paracel), a full-length gene cDNA sequence an...

example 3

Expression of GIPF in Murine and Human Tissues

A. Tissue Distribution of GIPF mRNA:

[0427]FIG. 2 shows the relative expression of GIPF mRNA that was derived from human (A) and murine (B) tissues.

[0428] Total mRNA was derived from the tissues indicated in FIG. 2 according to the protocol provided by the manufacturer (Qiagen, Valencia, Calif.). The RNA was subjected to quantitative real-time PCR (TaqMan) (Simpson et al., Molec Vision 6:178-183 (2000)) to determine the relative expression of GIPF in the tissues shown. The forward and reverse primers that were used in the PCR reactions of human RNA were: 5′ GACCATGCTGCCTGCTCTGACAC 3′ (forward; SEQ ID NO: 29), and 5′ CACCCGCCTCCTTGCTCTCC 3+ (reverse; SEQ ID NO: 30), respectively; and the forward and reverse primers that were used in the PCR reactions of murine RNA were: 5′ GGGGGAGACCACACCACCTGCT 3′ (SEQ ID NO: 31), and 5+ TTGGACCTCGGCTCCTTGCTGTTC 3′ (SEQ ID NO: 32), respectively. DNA sequences encoding Elongation Factor 1, α-actin, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular massaaaaaaaaaa
molecular weightaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

The invention relates to pharmaceutical compositions comprising gastrointestinal proliferative factor (GIPF) polynucleotides and polypeptides. The invention further relates to the therapeutic use of GIPF to prevent or treat conditions or disorders associated with the degeneration of the epithelial mucosa.

Description

RELATED APPLICATIONS [0001] This application claims priority from U.S. Provisional Application Ser. No. 60 / 539,605, filed Jan. 27, 2004 and U.S. Provisional Application Ser. No. 60 / 619,241, filed Oct. 15, 2004.1. BACKGROUND [0002] 1.1 Field of the Invention [0003] The present invention relates generally to compositions that comprise gastrointestinal proliferation factor polypeptides and polynucleotides, and methods for using the same. [0004] 1.2 Sequence Listing [0005] A sequence listing is provided. [0006] 1.3 Background [0007] Ionizing radiation therapy and cytotoxic chemotherapy produce injuries to the oral and gastrointestinal mucosa, which remain significant problems for patients undergoing antineoplastic treatments. Mucositis is the inflammation of the mucous membranes and is a particularly common problem in this patient population due to the use of chemotherapy and radiation therapy used with curative or palliative intent. The mucosal injuries to the gastrointestinal tract se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A01K67/027A61K38/18A61K48/00C07K14/475C12N15/85G01N33/50
CPCA01K67/0275A01K2217/072A01K2227/105A01K2267/01A61K48/005A61K38/1709C12N15/8509C12N2799/022C12N2800/30G01N33/5088C07K14/475A61P1/00A61P29/00A61P43/00A61K38/17A61K38/18
InventorBOYLE, BRYANFUNK, WALTERKAKITANI, MAKOTOOSHIMA, TAKESHIPARK, EUNTANG, Y.YAGI, MIKIOTOMIZUKA, KAZUMA
OwnerNUVELO INC