Gastrointestinal proliferative factor and uses thereof
a proliferative factor and gastrointestinal technology, applied in the field of gastrointestinal proliferative factor, can solve the problems of direct and indirect toxicity mucositis is the inflammation of the mucous membrane, and injury to the oral and gastrointestinal mucosa
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Isolation of SEQ ID NO: 1 from a Human cDNA Library
[0423] The novel nucleic acid of SEQ ID NO: 1 was obtained from a human cDNA library prepared from fetal skin (Invitrogen), using standard PCR, sequencing by hybridization sequence signature analysis, and Sanger sequencing techniques. The inserts of the library were amplified with PCR using primers specific for vector sequences flanking the inserts. These samples were spotted onto nylon membranes and interrogated with oligonucleotide probes to give sequence signatures. The clones were clustered into groups of similar or identical sequences, and a single representative clone was selected from each group for gel sequencing. The 5′ sequence of the amplified insert was then deduced using the reverse M13 sequencing primer in a typical Sanger sequencing protocol. PCR products were purified and subjected to fluorescent dye terminator cycle sequencing. Single-pass gel sequencing was done using a 377 Applied Biosystems (ABI) sequencer. The ...
example 2
Assemblage of SEQ ID NO: 2
[0424] The nucleic acid (SEQ ID NO: 2) of the invention was assembled from sequences that were obtained from a cDNA library by methods described in Example 1 above, and in some cases obtained from one or more public databases. The final sequence was assembled using the EST sequences as seed. Then a recursive algorithm was used to extend the seed into an extended assemblage, by pulling additional sequences from different databases (i.e. Nuvelo's database containing EST sequences, dbEST version 124, gbpri 124, and UniGene version 124) that belong to this assemblage. The algorithm terminated when there were no additional sequences from the above databases that would extend the assemblage. Inclusion of component sequences into the assemblage was based on a BLASTN hit to the extending assemblage with BLAST score greater than 300 and percent identity greater than 95%.
[0425] Using PHRAP (Univ. of Washington) or CAP4 (Paracel), a full-length gene cDNA sequence an...
example 3
Expression of GIPF in Murine and Human Tissues
A. Tissue Distribution of GIPF mRNA:
[0427]FIG. 2 shows the relative expression of GIPF mRNA that was derived from human (A) and murine (B) tissues.
[0428] Total mRNA was derived from the tissues indicated in FIG. 2 according to the protocol provided by the manufacturer (Qiagen, Valencia, Calif.). The RNA was subjected to quantitative real-time PCR (TaqMan) (Simpson et al., Molec Vision 6:178-183 (2000)) to determine the relative expression of GIPF in the tissues shown. The forward and reverse primers that were used in the PCR reactions of human RNA were: 5′ GACCATGCTGCCTGCTCTGACAC 3′ (forward; SEQ ID NO: 29), and 5′ CACCCGCCTCCTTGCTCTCC 3+ (reverse; SEQ ID NO: 30), respectively; and the forward and reverse primers that were used in the PCR reactions of murine RNA were: 5′ GGGGGAGACCACACCACCTGCT 3′ (SEQ ID NO: 31), and 5+ TTGGACCTCGGCTCCTTGCTGTTC 3′ (SEQ ID NO: 32), respectively. DNA sequences encoding Elongation Factor 1, α-actin, and...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular mass | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
| volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More