Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Oligonucleotides useful in methods for detecting and characterizing Aspergillus fumigatus

a technology of aspergillus and oligonucleotides, which is applied in the field ofoligonucleotides useful in methods for detecting and characterizing aspergillus fumigatus, can solve the problems of immunocompromised patients' morbidity and mortality, and the resistance to azole-based drugs impedes the successful treatment of infection by i

Inactive Publication Date: 2006-06-15
MEDICAL DIAGNOSTIC LAB
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0101] In more preferred embodiments, the first oligonucleotide probe is capable of hybridizing to at least a portion of a segment of the antisense strand of the amplicon, wherein the segment consists of nucleotides 274 through 295 of SEQ ID NO:15. Preferably, the first oligonucleotide probe is at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, or is 100% identical to the reverse complement of a segment of a polynucleotide based on the Clustal V or W alignment method using the default parameters, wherein the segment consists of nucleotides 274 through 295 of SEQ ID NO:15. More preferably, the first oligonucleotide probe comprises the nucleotide sequence of SEQ ID NO:48. Most preferably, the first oligonucleotide probe consists of the nucleotide sequence of SEQ ID NO:48. Advantageously, nucleotides 12, 13, and 14 of SEQ ID NO:48 are g, g, and t, respectively.
[0102] A

Problems solved by technology

Aspergillus fumigatus is the causative agent for medical conditions including invasive aspergillosis, which is a major cause of morbidity and mortality in immunocompromised patients.
Unfortunately, conventional laboratory tests for the presence of Aspergillus fumigatus, such as culture and galactomannan detection, lack sensitivity, and are rarely conclusive, resulting in true positive results only at advanced stages of infection or necessitating invasive procedures for formal microbiological evaluation (see Denning, 1998, Invasive aspergillosis.
Furthermore, the emergence of clinical resistance to azole-based drugs impedes successful treatment of infection by Aspergillus fumigatus (see Denning et al., 1997, Itraconazole resistance in Aspergillus fumigatus.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotides useful in methods for detecting and characterizing Aspergillus fumigatus
  • Oligonucleotides useful in methods for detecting and characterizing Aspergillus fumigatus

Examples

Experimental program
Comparison scheme
Effect test

examples

[0106] A region of cyp51A of Aspergillus fumigatus 269 base pairs in length was amplified using the Rotor-Gene 3000 platform (Corbett Research, Sydney, Australia). A dual-labeled DNA probe was employed for real-time monitoring of amplification by the polymerase chain reaction (“PCR”). The PCRs were carried out in a volume of 25 μl containing a 300 nM concentration of each primer (forward primer: 5′-TCATTGGGTCCCATTTCTGGGTAG-3′ (SEQ ID NO:16), reverse primer: 5′-biotin / TAGACCTCTTCCGCATTGACATCC-3′) (SEQ ID NO:17 with the addition of a biotin moiety), 100 nM probe (5′-6-FAM / AAACCACAGTCTACCTGGGCGTTCA / BHQ-1-3′) (nucleotide sequence of SEQ ID NO:26 with the addition of a 6-FAM moiety and a BHQ-1 moiety, wherein the 6-FAM moiety is 6-carboxy-fluorescein and the BHQ-1 moiety is Black Hole Quencher 1), and 12.5 μl of a 2× concentration of Platinum Quantitative PCR Supermix-UDG (Invitrogen, Carlsbad, Calif.). Parameters for the PCRs were as follows: an initial incubation at 50° C. for 2 minute...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Login to View More

Abstract

Oligonucleotides and methods for using these oligonucleotides in the detection of Aspergillus fumigatus are disclosed. Aspergillus fumigatus is the causative agent for medical conditions including invasive aspergillosis. The oligonucleotides of the invention have nucleotide sequences derived from the gene encoding the cytochrome P450 14 alpha-sterol demethylase (i.e., the Cyp51A protein) of Aspergillus fumigatus. The oligonucleotides of the invention include forward primers and reverse primers which in combination are capable of priming the synthesis of amplicons specific to cyp51A in polymerase chain reactions using nucleic acids isolated from Aspergillus fumigatus as templates. The oligonucleotides of the invention also include probes capable of detecting these cyp51A-specific amplicons. Thus, a biological sample is tested for the presence of Aspergillus fumigatus by isolating nucleic acid from the sample, conducting a polymerase chain reaction in a mixture containing this nucleic acid and these forward and reverse primers, and then determining, using an oligonucleotide probe, whether an amplicon is produced in the mixture, wherein detection of the amplicon indicates the presence of Aspergillus fumigatus in the sample. The oligonucleotides of the invention also include primers for nucleotide sequencing reactions to determine whether an isolate of Aspergillus fumigatus is more tolerant than wild-type Aspergillus fumigatus to a triazole, which is a compound commonly used as an antifungal drug. Specifically, a strand of a cyp51A-specific amplicon is at least partially sequenced using a nucleotide sequencing primer in a primer extension reaction. Identification of mutations giving rise to amino acid substitutions at positions 54, 138, 220, and 448 of the amino acid sequence of the wild-type Cyp51A protein indicates that the isolate of Aspergillus fumigatus from which the amplicon is derived exhibits decreased susceptibility to at least one triazole.

Description

CROSS REFERENCES TO RELATED APPLICATIONS [0001] The present application claims benefit, under 35 U.S.C. 119(e), to U.S. Provisional Application No. 60 / 636,133, entitled “A Method for Detecting Triazole Resistant-Aspergillus Fumigatus,” filed on Dec. 15, 2004, the entire contents of which are hereby incorporated by reference.BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The present invention is broadly concerned with oligonucleotides useful in methods for detecting and characterizing Aspergillus fumigatus. More particularly, the present invention relates to oligonucleotides having nucleotide sequences derived from the gene encoding the cytochrome P450 14 alpha-sterol demethylase (i.e., the Cyp51A protein) of Aspergillus fumigatus, wherein these oligonucleotides are useful as forward and reverse primers for a polymerase chain reaction using nucleic acids from a biological sample as a template, as probes for detecting any resultant cyp51A-specific amplicon indicat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C07H21/04
CPCC12Q1/689C12Q1/6895C12Q2561/113C12Q2565/301C12Q2600/156
Inventor TRAMA, JASONADELSON, MARTINMORDECHAI, ELI
Owner MEDICAL DIAGNOSTIC LAB
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products