Unlock instant, AI-driven research and patent intelligence for your innovation.

Cloning and/or sequencing vector

a technology of cytotoxic gene and cloning method, which is applied in the field of cloning and/or sequencing vectors, can solve the problems of cytotoxic gene completely repression, unstable and awkward use, and high cost of the blue screen technique, and achieve the effect of being relatively inexpensive to construct and produ

Inactive Publication Date: 2008-12-04
UNIV LIBRE DE BRUXELIES
View PDF15 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides a new cloning and sequencing vector that is simple and inexpensive to create and produce. This vector allows for the selection of recombinant clones without the disadvantages of current methods. It also allows for the sequencing, amplification, and characterization of foreign DNA fragments in the cloning vector without causing selective pressure or death of the host strain. The vector has been designed to allow for easy extraction of the foreign DNA fragment from the cloning vector. The vector is also host strain-specific, allowing for the production of large numbers of copies without affecting the host strain. The vector is a recombinant virus or plasmid that includes a promoter nucleotide sequence and a nucleotide sequence encoding a fusion protein that acts as a poison. The vector can be used for selecting and sequencing recombinant clones.

Problems solved by technology

However, this “blue screen” technique suffers from the disadvantage of using a screening procedure (discrimination) rather than a procedure for selecting the clones.
Moreover, this complex procedure requires the use of the substrate X-gal which is a product which is very expensive, unstable and awkward to use.
However, it is difficult, if not impossible, to repress the cytotoxic gene completely, particularly if a large number of copies of the vector are required.
However, this insertion of a foreign gene into a restriction site located in the sequence of the E gene, encoding gpE, makes it more difficult to sequence the foreign gene and / or amplify it by PCR since, in this case, portions of useless sequences belonging to the E gene encoding gpE are also sequenced, amplified and characterised.
The cloning vectors of the state of the art suffer from the disadvantage of having to be maintained in a host strain which includes the LacIq repressor in episomal form, or the CI repressor, in order to inactivate the promoter and prevent expression of the killer gene, leading to the death of the host strain.
In addition, if it is desired to use this strain to produce a large number of copies of the cloning vectors, the repressor will not be adequate for preventing either a selective pressure which modifies the cytotoxic activity of the vector or a “genetic leakage”, that is to say expression of certain copies of the vector and death of the host strain.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning and/or sequencing vector
  • Cloning and/or sequencing vector

Examples

Experimental program
Comparison scheme
Effect test

example i

Construction of the Plasmid pKIL19

[0071]The ccdB gene was amplified by PCR using, as DNA template, the plasmid pULB2208 (Bernard and Couturier, The 41 carboxy-terminal residues of the miniF plasmid CcdA protein are sufficient to antagonise the killer activity of the CcdB protein, Mol. Gen. Genet. 226, 297-304 (1991) as well as synthetic oligonucleotides.

[0072]The synthetic oligonucleotide sequences were selected in such a way as to create an EcoRI restriction site on either side of the wild-type ccdB gene in order to be able to reclone this gene in frame with the codons of the MC S19 multiple cloning site and to eliminate the initiation codon of the native ccdB gene. The DNA resulting from the PCR reaction was digested with the enzyme EcoRI and cloned into the EcoRI site of the plasmid pUC19. The resulting plasmid, in which the EcoRI fragment was integrated in the orientation which permitted the ccdB gene, provided with the additional codons corresponding to the MCS19 multiple cloni...

example ii

Construction of the Plasmid pKIL18

[0075]The ccdB gene was amplified by PCR using, as DNA template, plasmid pKIL19 as well as synthetic oligonucleotides. The sequences of the synthetic oligonucleotides were selected in such a way as to create a HindIII site on either side of the ccdB gene in order to be able to reclone this gene in frame with the codons of the MCS18 multiple cloning sites. The DNA resulting from the PCR reaction was digested by the enzyme HindIII and cloned into the HindIII site of the plasmid pUC18. The resulting plasmid, in which the HindIII fragment was integrated in the orientation which permitted the ccdB gene, provided with the additional codons corresponding to the MC S18 multiple cloning sites, to be read from the Lac promoter, was termed pKIL4. Plasmid pKIL4 is lethal for a CcdbS-sensitive bacterium.

[0076]The HindIII site downstream of the ccdB gene was eliminated by filling in its cohesive ends. The resultant plasmid, pKIL18 ((SEQ ID NO:4 and SEQ ID NO:6), ...

example iii

Construction of the Plasmid pKID18

[0077]ParD is a killer stability system of R1 plasmid located in the proximity of the basic replicon. It is a small operon containing two genes, Kid and K is, coding for a killer component and its antagonist respectively (Bravo et al., Mol. Gen. Genet., Vol. 215, pp. 146-151 (1988)). This system is perfectly conserved and functional in another incFII plasmid, R100 (pem system: Tsuchimoto et al., J. of Bacteriol., Vol. 170, pp. 1461-1466 (1988)), PemA (identical to Kis) and PemB (identical to Kid).

[0078]The vectors pKID18 and pKID19 contain the Kid gene fused to different polylinkers (MCS18 and MSC19 for pKID18 and pKID19 respectively). The Kid sequence was amplified by PCR from the plasmid R1 drd19 using the primers kid1—gaggaattcattgggaaagaggggaaatctg—(SEQ ID NO:7) and kid2—gaggaattctcaagtcagaatagtggaca—(SEQ ID NO: 8). The generated insert was cloned into the EcoRI site of pUC19 (Yanish-Perron et al. (1985)). This insertion generates a fusion gene ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
sizeaaaaaaaaaa
coloraaaaaaaaaa
pressureaaaaaaaaaa
Login to View More

Abstract

A cloning and / or sequencing vector enables recombinant clones to be selected directly. The vector encodes a fusion protein which includes a protein poison.

Description

RELATED APPLICATIONS[0001]This application is a continuation application which claims priority under 35 U.S.C. § 120 to U.S. patent application Ser. No. 09 / 634,039, entitled CLONING AND / OR SEQUENCING VECTOR, filed Aug. 8, 2000, which is a continuation of U.S. patent application Ser. No. 09 / 225,152, entitled CLONING AND / OR SEQUENCING VECTOR, filed Jan. 4, 1999 and issued as U.S. Pat. No. 6,180,407, which is a continuation-in-part of U.S. patent application Ser. No. 08 / 379,614, entitled CLONING AND / OR SEQUENCING VECTOR, filed Jul. 20, 1995 and issued as U.S. Pat. No. 5,910,438, which is the U.S. National Phase under 35 U.S.C. § 371 of International Application PCT / BE93 / 00051, entitled CLONING AND / OR SEQUENCING VECTOR, filed Aug. 2, 1993 and published in English as PCT Publication No. WO94 / 03616, which claims priority to Belgian Application No. BE 9200696, filed Jul. 31, 1992.SEQUENCE LISTING[0002]The present application is being filed along with a Sequence Listing in electronic format...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N15/74C12N15/09C12N1/21C12N15/70C12R1/19
CPCC12N15/70
Inventor BERNARDGABANT, PHILIPPE
Owner UNIV LIBRE DE BRUXELIES