Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof

a polymorphism and probe technology, applied in the field of probes for detection of polymorphisms in egfr genes, can solve the problems of high labor intensity, contamination risk of separate subsequent reactions, and difficult to detect polymorphisms, and achieve simple and highly reliable determination of polymorphisms, high reliability, and high reliability

Inactive Publication Date: 2012-05-03
ARKRAY INC
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0012]For the above reasons, the detection of polymorphisms in an EGFR gene is important in relation to the selection of a method of treatment for a disease. Therefore, it is an object of the present invention to provide a polymorphism-detection probe configured to enable determination of a polymorphism comprising a one-nucleotide difference in a simple manner and with superior reliability, and to a method of detection of a polymorphism.
[0045]The method for detecting a polymorphism according to some embodiments of the present invention enables simple and highly reliable determination of a polymorphism in an EGFR gene by use of the probe for detecting a polymorphism according to the present invention. More specifically, even when the target polymorphism coexists in a mutant EGFR gene and a wild-type EGFR gene in a sample, the wild-type and mutant polymorphisms can be determined in a simple manner and with high reliability. Furthermore, the primer according to the present invention enables specific amplification of the domain including the polymorphism in the EGFR gene. In this manner, according to the present invention, since the polymorphism in the EGFR gene can be amplified and determined in a simple manner with high reliability, the detection results for example can be reflected in the selection of a regime of treatment for a disease as described above. For example, the efficacy of or resistance to EGFR-TKI of gefitinib and the like can be determined. Furthermore, the present invention enables application to the detection of a polymorphism in an EGFR gene in diverse areas including biochemistry in addition to medical fields.

Problems solved by technology

However, a patient may exhibit an improvement in the effect of gefitinib in shrinking a tumor, or resistance to gefitinib may preclude a therapeutic effect.
However, the PCR-RFLP method is labor intensive and in the event that an amplification product becomes dispersed, there is a risk of contamination of a separate subsequent reaction.
These problems are related to difficulties associated with automatization of detection of polymorphisms.
In recent years, these problems have resulted in detection using melting curve analysis (Tm analysis) as a method of detection of gene polymorphism.
However, a detection method using this type of Tm analysis determines at least a one-nucleotide difference on the basis of the Tm value, and therefore when there is a plurality of genetic polymorphisms, the analysis of a single sample is extremely labor-intensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof
  • Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof
  • Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0285]Tm analysis was performed in the common presence of a wild-type plasmid and a mutant-type plasmid in order to detect an EGFR858 polymorphism in an EGFR gene.

[0286]The wild-type plasmid and a mutant-type plasmid are prepared as an EGFR858 wild-type plasmid (L858WT) and as an EGFR858 mutant-type plasmid (L858R). The EGFR858 wild-type plasmid (L858WT) includes a partial sequence of the EGFR gene by insertion of the oligonucleotides from position 112 to position 411 of SEQ ID NO: 1, and in which the nucleotide (k) at position 261 of SEQ ID NO: 1 is thymine (t). The EGFR858 mutant-type plasmid (L858R) includes a partial sequence of the EGFR gene by insertion of the oligonucleotides from position 112 to position 411 of SEQ ID NO: 1, and in which the nucleotide (k) at position 261 of SEQ ID NO: 1 is guanine (g). These plasmids are mixed in a predetermined ratio as shown below to thereby prepare three types of samples. These samples include 250 plasmid copies per μL.

TABLE 3Mixing Rati...

example 2

[0292]In the present example, Tm analysis was respectively executed in relation to wild-type artificial nucleic acid and mutant-type artificial nucleic acid to thereby detect the EGFR 858 polymorphism in the EGFR gene.

[0293]EGFR858 wild-type artificial nucleic acid (EGFR-L858R(WT)-F) and EGFR858 mutant-type artificial nucleic acid (EGFR-L858R(MT)-F) that is homologous to positions 241 to 290 SEQ ID NO: 1 as illustrated in the sequence below were prepared. In the following two sequences, the underlined portion corresponds to the nucleotide at position 261 SEQ ID NO: 1. The respective artificial nucleic acids were adjusted to 5 μmol / L and were used as test samples.

EGFR-L858R(WT)-F(SEQ ID NO: 32)caagatcacagattttgggctggccaaactgctgggtgcggaagagaaagEGFR-L858R(MT)-F(SEQ ID NO: 33)caagatcacagattttgggcgggccaaactgctgggtgcggaagagaaag

[0294]Tm analysis was performed in relation to 25 μL of the reaction solution as illustrated in Table 5 using a fully automatic SNPs detection apparatus (product na...

example 3

[0298]In the present example, Tm analysis was performed in relation to wild-type oligonucleotides and mutant-type oligonucleotides to thereby detect the EGFR gene exon19 polymorphism. The detection wavelength of BODIPY FL was 520-555 nm, and the detection wavelength of TAMRA was 585-700 nm.

(1) Oligonucleotide

[0299]The wild-type and mutant-type oligonucleotides were prepared using the oligonucleotides 1-18 in Table 6. These oligonucleotides are sequences that are complementary to the sense strand of the EGFR gene. The oligonucleotide 1 is the wild-type oligonucleotide, and is complementary to the partial sequence of the sense strand including the exon19 polymorphism 1. The oligonucleotides 2-18 are the mutant-type oligonucleotides, and are complementary to the partial sequence of the sense strand including the exon19 polymorphisms 2-18. Table 6 shows the corresponding domain in the nucleotide sequence of SEQ ID NO: 2 for each oligonucleotide. The range of the nucleotide sequence cont...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Temperatureaaaaaaaaaa
Temperatureaaaaaaaaaa
Login to View More

Abstract

A polymorphism-detecting probe, an amplification primer and the use thereof are provided to enable simple and highly reliable determination of different polymorphisms in an EGFR gene.

Description

CROSS-REFERENCE TO RELATED APPLICATION[0001]This application claims priority from Japanese Patent Application No. 2010-244643 filed on Oct. 29, 2010. The entire subject matter of the Japanese Patent Application is incorporated herein by reference in its entirety.SEQUENCE LISTING SUBMISSION VIA EFS-WEB[0002]A computer readable text file, entitled “SequenceListing.txt,” created on or about Oct. 26, 2011 with a file size of about 19 kb contains the sequence listing for this application and is hereby incorporated by reference in its entirety.BACKGROUND OF THE INVENTION[0003]The present invention relates to a probe configured to detect a polymorphism in an EGFR gene, an amplification primer, and the use thereof.[0004]Epidermal growth factor receptor (EGFR) is the tyrosine kinase receptor for epidermal growth factor (EGF). EGFR is associated with a high frequency of expression in many solid tumors, and overexpression is known to be related to the malignancy or prognosis of a cancer. In th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N25/04C07H21/04
CPCC12Q2600/156C12Q1/6886C12Q2600/106C12Q2563/107
Inventor IGUCHI, AKIIJUIN, MOEKO
Owner ARKRAY INC
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com