Methods of detecting multi-drug resistant organisms
a multi-drug resistant organism and detection method technology, applied in the field of multi-drug resistant organism detection, can solve the problems of poor clinical outcomes, increased morbidity, mortality, healthcare costs of infected patients, and extremely limited treatment options for patients with multi-drug resistant organisms (mdros), so as to reduce overall costs, reduce patient death rates, and reduce patient length of stay
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
[0351]The MDRO test uses anal swabs collected using ESwabs™ from Copan or Becton Dickinson (BD). Collected ESwabs™ should be properly labeled, stored and transported to OpGen at room temperature (20-25 C) or 4 to 8 C. ESwabs™ should be tested within 48 hours of collection.
example 2
PCR Primer and Probe Sequences
[0352]Exemplary primer and probe sequences useful in the methods of the invention include those listed below in Tables 2, 8 and 9. It is readily apparent to those skilled in the art that other primer and probe sequence may be utilized in practicing the claimed methods.
TABLE 2Reagent or MediarSequenceInternalGATTGCCACGCATTGAGCTAgcgagtcagcgataagcatgacgcgctttcaagcAmplificationgtcgcgagtatgtgaaccaaggctccggacaggactatatacttgggtTTGATCTCGCCCControlCGACAAGAACGGGATTGACTGTTTGACActagctggtgttcggttcggtaacggagaatctgtggggctatgtcactaatactttcgaaacgccccgtaccgatgcTGAACAAGTCGATGCAGGCTGGATGAGTGTGACGGAGTGTAactcgatgagttacccgctaatcgaactgggcgagagatcccagcgctgatgcactcgatcccgaggcctgacccgacaTATCAGCTCAGACTAGAGCGGGCTGCGCATAAGCAAATGACaattaaccactgtgtactegttataacatctggcagttaaagtegggagaataggagccgcaatacacagtttaccgcatctagacctaacTGAGATACTGCCATAGACGACT(SEQ ID NO: 1)kpc-FOGGAACCATTCGCTAAACTCGAAC (SEQ ID NO: 2)kpc-ROAATGAGCTGCACAGTGGGAA (SEQ ID NO: 3)ndm-FOCGGCCACACCAGTGACAATA (SEQ ID NO: 4)ndm-...
example 3
[0353]Controls for MDRO Assay are used at 3 different levels. First one represents a set of controls (NEC, PEC, NTC and the Internal Amplification Control (IAC) reaction) that are required to qualify a given assay run and are defined as “Assay Run controls”. These controls are evaluated first for any given assay run and once accepted, the second level of controls (NEC, PEC, and NTC for each target) are assessed for each of the MDRO targets in the Assay run. This second level of controls qualifies a given target and is defined as “Target Controls”. Once a given target is accepted, results for each sample are evaluated against a third level that represents an Internal Amplification Control (IAC) for each and every sample to evaluate inhibition of amplification and / or detection.
[0354]The positive extraction control (PEC) monitors for any reagent failure during RT-PCR. The negative extraction control (NEC) detects reagent or environment contamination by any target DNA thr...
PUM
| Property | Measurement | Unit |
|---|---|---|
| weight percent | aaaaa | aaaaa |
| weight percent | aaaaa | aaaaa |
| weight percent | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
