Unlock instant, AI-driven research and patent intelligence for your innovation.

Methods of detecting multi-drug resistant organisms

a multi-drug resistant organism and detection method technology, applied in the field of multi-drug resistant organism detection, can solve the problems of poor clinical outcomes, increased morbidity, mortality, healthcare costs of infected patients, and extremely limited treatment options for patients with multi-drug resistant organisms (mdros), so as to reduce overall costs, reduce patient death rates, and reduce patient length of stay

Inactive Publication Date: 2015-09-17
OPGEN INC
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention is a method to use a database of test results to improve treatment procedures in healthcare institutions. The method helps to lower patient stays, reduce costs, decrease patient death rates due to resistant microorganisms, minimize CMS penalties for HAIs, and decrease legal settlements due to wrongful death claims.

Problems solved by technology

Antibiotic-resistant bacterial infections are associated with poor clinical outcomes including increased morbidity, mortality, and healthcare costs among infected patients.
Treatment options for patients with multi-drug resistant organisms (MDROs) are extremely limited; therefore prevention of transmission within these facilities is paramount.
Classical culture methods for detection of MDROs are time consuming (48-72 hours), leading to delays, inappropriate treatment and patient isolation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods of detecting multi-drug resistant organisms
  • Methods of detecting multi-drug resistant organisms
  • Methods of detecting multi-drug resistant organisms

Examples

Experimental program
Comparison scheme
Effect test

example 1

Specimen Handling

[0351]The MDRO test uses anal swabs collected using ESwabs™ from Copan or Becton Dickinson (BD). Collected ESwabs™ should be properly labeled, stored and transported to OpGen at room temperature (20-25 C) or 4 to 8 C. ESwabs™ should be tested within 48 hours of collection.

example 2

PCR Primer and Probe Sequences

[0352]Exemplary primer and probe sequences useful in the methods of the invention include those listed below in Tables 2, 8 and 9. It is readily apparent to those skilled in the art that other primer and probe sequence may be utilized in practicing the claimed methods.

TABLE 2Reagent or MediarSequenceInternalGATTGCCACGCATTGAGCTAgcgagtcagcgataagcatgacgcgctttcaagcAmplificationgtcgcgagtatgtgaaccaaggctccggacaggactatatacttgggtTTGATCTCGCCCControlCGACAAGAACGGGATTGACTGTTTGACActagctggtgttcggttcggtaacggagaatctgtggggctatgtcactaatactttcgaaacgccccgtaccgatgcTGAACAAGTCGATGCAGGCTGGATGAGTGTGACGGAGTGTAactcgatgagttacccgctaatcgaactgggcgagagatcccagcgctgatgcactcgatcccgaggcctgacccgacaTATCAGCTCAGACTAGAGCGGGCTGCGCATAAGCAAATGACaattaaccactgtgtactegttataacatctggcagttaaagtegggagaataggagccgcaatacacagtttaccgcatctagacctaacTGAGATACTGCCATAGACGACT(SEQ ID NO: 1)kpc-FOGGAACCATTCGCTAAACTCGAAC (SEQ ID NO: 2)kpc-ROAATGAGCTGCACAGTGGGAA (SEQ ID NO: 3)ndm-FOCGGCCACACCAGTGACAATA (SEQ ID NO: 4)ndm-...

example 3

Quality Control

[0353]Controls for MDRO Assay are used at 3 different levels. First one represents a set of controls (NEC, PEC, NTC and the Internal Amplification Control (IAC) reaction) that are required to qualify a given assay run and are defined as “Assay Run controls”. These controls are evaluated first for any given assay run and once accepted, the second level of controls (NEC, PEC, and NTC for each target) are assessed for each of the MDRO targets in the Assay run. This second level of controls qualifies a given target and is defined as “Target Controls”. Once a given target is accepted, results for each sample are evaluated against a third level that represents an Internal Amplification Control (IAC) for each and every sample to evaluate inhibition of amplification and / or detection.

[0354]The positive extraction control (PEC) monitors for any reagent failure during RT-PCR. The negative extraction control (NEC) detects reagent or environment contamination by any target DNA thr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
weight percentaaaaaaaaaa
weight percentaaaaaaaaaa
weight percentaaaaaaaaaa
Login to View More

Abstract

The present invention provide methods using genes associated with multi-drug resistance for rapidly detecting a patient colonized or infected with an multi-drug resistant organism and administrating the appropriate precautions and / or treatment.

Description

RELATED APPLICATIONS[0001]This application claims priority to and benefit of U.S. Provisional Patent Application No. 61 / 952,795, filed Mar. 13, 2014 and U.S. Provisional Patent Application No. 62 / 116,860, filed Feb. 16, 2015, the contents of which are each incorporated herein by reference in its entirety.SEQUENCE LISTING[0002]The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 1, 2015, is named OPGN-014US_ST25.txt and is 71,030 bytes in size.FIELD OF THE INVENTION[0003]The present invention, relates generally to the identification and characterization of genes and gene families associated with multi-gene resistance in biological samples in the screening, diagnosis, therapy, epidemiological surveillance, and monitoring of multi-gene resistant colonization and infection.BACKGROUND OF THE INVENTION[0004]Antibiotic-resistant bacterial infections a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12Q1/68G06F19/00G06F19/20G16B25/10G16H40/60G16Z99/00
CPCC12Q1/689C12Q2600/158G06F19/3456G06F19/20C12Q1/6883C12Q2600/106G16Z99/00G16B25/10G16B25/00G16H40/60Y02A90/10G16H20/10G16H10/40
Inventor WALKER, GEORGE TERRANCEROCKWEILER, TONYSAEED, ALEXSAPIRO, VADIMKERSEY, ROSSIO
Owner OPGEN INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More