Methods of using acyl-coa synthetase for biosynthetic production of acyl-coas

a technology of acylcoa and synthetase, which is applied in the field of biosynthetic production of acylcoas utilizing acylcoa synthetase, can solve the problems that no biochemical activity has been attributed to any of these proteins, and achieve the effect of facilitating the production of acylcoas and facilitating the subsequent production of capsaicin

Active Publication Date: 2017-08-31
CONAGEN INC
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This method enables the industrial production of 8-methyl-6-nonenoyl-CoA, a key substrate for capsaicin synthesis, and demonstrates the biochemical activity of ACS1, potentially modifying capsaicinoid levels in pepper plants and providing applications in the biofuel industry.

Problems solved by technology

However, no biochemical activity has been ascribed to any of these proteins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods of using acyl-coa synthetase for biosynthetic production of acyl-coas
  • Methods of using acyl-coa synthetase for biosynthetic production of acyl-coas
  • Methods of using acyl-coa synthetase for biosynthetic production of acyl-coas

Examples

Experimental program
Comparison scheme
Effect test

example 1

Producing Acyl-CoAs

Cloning

[0032]Applicants amplified ACS1 gene from the cDNA of the green fruits of the ghost chili pepper using the primers of ACS1-sumo-F: CGC GAA CAG ATT GGA GGT GCAACAGATAAATTTATTATTG and ACS1-sumo-R: GTG GCG GCC GCT CTA TTA TCACTTGGTACCCTTGTACAT. The resulting PCR product was purified on 1% agarose gel and mixed with linear pETite N-His SUMO Kan expression vector (Lucigen, Middleton, Wis.). The DNA mixture was used to transform HI-control 10G chemically competent cells by heat shock (Lucigen). The gene insertion was fully sequenced and the encoded amino acid sequence was aligned with that of ACS1 (FIG. 5). As shown in FIG. 5, these two sequences are almost identical except Ile476 in Capsicum annuum ACS1 is replaced by Val in ghost pepper ACS1. The sequence of ghost pepper ACS1 was used to blast Arabidopsis database (http: / / www.arabidopsis.org / ) and identified LCAS4 and LACS5 as its homologues (FIG. 6). As shown in FIG. 6, these three sequences share a sequence i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
flow rateaaaaaaaaaa
carboxylic acidaaaaaaaaaa
timeaaaaaaaaaa
Login to View More

Abstract

A biosynthetic method of making carboxyl CoA from long-chain carboxylic acid including expressing an ACS in a cellular system, feeding a long chain carboxylic acid to the cellular system, growing the cellular system in a medium, and producing carboxyl CoA.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This disclosure is a PCT Patent application entitled Methods of Using Acyl-CoA Synthetase for Biosynthetic Production of Acyl-CoAs. This application claims priority to U.S. Provisional Patent application No. 61 / 898,944 filed on Nov. 1, 2013, which is incorporated by reference herein in its entirety.TECHNICAL FIELD[0002]This disclosure has applicability in the food, medicinal, and pharmacological industries. This disclosure relates generally to a method for the biosynthetic production of acyl-CoAs utilizing acyl-CoA synthetase (ACS).BACKGROUND OF THE DISCLOSUREBackground Art[0003]Capsaicin, 8-methyl-N-vanillyl-trans-6-nonenamide, is a secondary metabolite produced in hot peppers (Capsicum spp.) that is responsible for their pungent flavor. As noted in FIG. 1, Capsaicin is believed to be synthesized by capsaicin synthase (CS), an acyltransferase that transfers the 8-methylnonenoyl moiety from 8-methylnonenoyl-CoA to vanillylamine to form an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12P19/32
CPCC12P19/32C12N15/8243C12Y602/01001
InventorCHEN, HUIWANG, HONGXUE
OwnerCONAGEN INC