Phytophthora resistant plants belonging to the solanaceae family

a technology of solanaceae and phytophthora, which is applied in the field of phytophthora resistance plants belonging to the solanaceae family, can solve the problems of long-standing problems of the agricultural industry, large economic losses on crops worldwide, and environmental damage in natural ecosystems

Inactive Publication Date: 2019-10-10
ENZA ZADEN BEHEER BV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent describes a way to make plants resistant to a disease called Phytophthora by reducing the expression of certain genes or the activity of proteins encoded by them. This approach is effective in plants of the Solanaceae family, which include tomatoes and peppers. By doing this, researchers hope to create more robust and disease-resistant plants.

Problems solved by technology

The plant pathogen Phytophthora is a genus of plant-damaging Oomycetes (water molds), whose member species are capable of causing large economic losses on crops worldwide, as well as environmental damage in natural ecosystems.
The soybean root and stem rot agent, Phytophthora sojae, has also caused longstanding problems for the agricultural industry.
In general, plant diseases caused by this genus are difficult to control chemically, and thus the growth of resistant cultivars is the main management strategy.
Many members of the family contain potent alkaloids, and some are highly toxic.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phytophthora resistant plants belonging to the solanaceae family
  • Phytophthora resistant plants belonging to the solanaceae family
  • Phytophthora resistant plants belonging to the solanaceae family

Examples

Experimental program
Comparison scheme
Effect test

example 1 (

Potato)

[0033]RNAi constructs targeting potato SEQ ID NO. 7 and SEQ ID NO. 8

[0034]3 Different RNAi Constructs were made, Harboring / Targeting:

[0035]1. 5′ end of SEQ ID NOS 7: equivalent to coding sequence -159-200 (−159 from start means in 5′UTR).

[0036]2. Chimera of 5′ end of SEQ ID NO. 7 and SEQ ID NO. 8: equivalent to coding sequence 4-199+1-204.

[0037]3. Middle part of SEQ ID NO. 7 (highly homologous to middle of SEQ ID NO. 8): equivalent to coding sequence 334-743.

[0038]The fragments were amplified from genomic DNA and cloned into the pENTR-D-TOPO vector. For the chimeric construct, 2 fragments were coupled using primers with complementary overhangs, and subsequent extension and amplification to create the fused fragment. Fragments were transferred using a Gateway LR reaction to the RNAi vector pK7GWiWG2 (Karimi et al., 2002, Trends Plant Sci 7), creating an inverted repeat with hairpin structure. Because the pK7GWiWG2 vector requires Streptomycin for bacterial selection, and the A...

example 2 (

Petunia)

[0042]Transposon insertion lines were identified from a collection / library (Vandenbussche et al., 2008, Plant Journal 54). 2 dTph1 transposon insertion alleles were found in SEQ ID NO. 9 and 3 dTph1 transposon insertion alleles in SEQ ID NO. 10. Several crosses were made to generate double mutants.

[0043]Phytophthora nicotianae Assay details

[0044]Plants were grown in standard potting soil, individually potted, at 23C. P.nicotianae spores were harvested from cultures (lima-bean-agar or V8-agar plates), and 2 ml of spore suspension containing 10e4 (assay Sept) spores was dripped onto the soil with each plant. Plant collapse was monitored regularly.

[0045]As shown in FIG. 4, double mutants, i.e. plants having mutations in both SEQ ID NO. 9 and SEQ ID NO. 10 have a percentage of living plants of 45%, whereas the percentage of living plants of single mutants (mutant in SEQ ID NO. 9 or SEQ ID NO. 10) is only 20%.

example 3 (

Tomato)

[0046]Tomato plants were transformed with two constructs, either for providing over expression of both SEQ ID NO. 11 and SEQ ID NO. 12, or for providing silencing of both SEQ ID NO. 11 and SEQ ID NO. 12.

[0047]Tomato SEQ ID NO. 11 silencing constructs were generated using Gateway cloning of a 300 bp fragment identical to the middle part of the CDS of SEQ ID NO. 11.

[0048]Sequence:

(SEQ ID NO. 15)TTGGGTGAACAAGGACAACATATGGCTATCAATTATTATCCTCCTTGTCCACAACCAGAACTTACTTATGGGCTTCCGGCCCATACTGATCCAAATTCACTTACAATTCTTCTTCAAGACTTGCAAGTTGCGGGTCTTCAAGTTCTTAAAGATGGCAAATGGTTAGCTGTAAAACCTCAACCTGACGCCTTTGTCATTAATCTTGGGGATCAATTGCAGGCAGTAAGTAACGGTAAGTACAGAAGTGTATGGCATCGAGCTATTGTGAATTCAGATCAAGCTAGGATGTCAGTGGCTTCGTTT 

[0049]Using Primers:

S. lycopersicum AttB1-F(SEQ ID NO. 13)aaaaagcaggcttcttgggtgaacaaggacaacaS. lycopersicum AttB2-R(SEQ ID NO. 14)agaaagctgggtaaaacgaagccactgacatcc

[0050]The generated ENTRY vector was Gateway cloned into the pHellsgatel2 binary vector. Following Agrobacterium transformation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
RHaaaaaaaaaa
sizeaaaaaaaaaa
resistanceaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a plant belonging to the Solanaceae family wherein said plant comprises a genetic trait providing Phytophthora resistance and wherein said resistance trait is encoded by a combination of at least two genes having a reduced expression, or transcription, of said genes or a reduced activity of proteins encoded by said genes as compared to said plant belonging to Solanaceae family being susceptible to Phytophthora.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application is a Continuation of U.S. patent application Ser. No. 16 / 055,697, filed Aug. 6, 2018, which is a Continuation of U.S. patent application Ser. No. 15 / 111,285, internationally filed Jan. 14, 2014, which is a U.S. National Phase application under 35 U.S.C. § 371 of International Application No. PCT / EP2014 / 050572, filed Jan. 14, 2014, each of which are incorporated herein by reference in their entirety.SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE[0002]The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 701802011903SEQLIST.TXT, date recorded: Mar. 18, 2019, size: 27 KB).FIELD OF THE INVENTION[0003]The present invention relates to Phytophthora resistance plants belonging to Solanaceae family wherein said resistance is encoded by a combination of two genes. The present invention further relates to t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/82C12N9/02
CPCC12N15/8282C12N15/8279C12N9/0071
InventorVAN SCHIE, CHRISTIANUS CORNELIS NICOLAASZEILMAKER, TIEME
OwnerENZA ZADEN BEHEER BV