Unlock instant, AI-driven research and patent intelligence for your innovation.

Tumor correlated albumen, coding gene and application thereof

A tumor-related, gene-encoding technology, applied in the field of tumor-related proteins and their encoded genes and applications, can solve problems such as unconfirmed

Inactive Publication Date: 2007-10-17
CANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI +1
View PDF0 Cites 24 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The appearance of the DENN domain in proteins such as Rab3GEP indicates that it may have guanylate exchange activity, but this inference has not yet been confirmed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor correlated albumen, coding gene and application thereof
  • Tumor correlated albumen, coding gene and application thereof
  • Tumor correlated albumen, coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Cloning of embodiment 1, DENND2D-v2 and DENND2D-v1 and cDNA gene thereof

[0054] The specific primer sequences for the full-length reading frames of the DENND2D-v1 and DENND2D-v2 genes were respectively designed for the sequences 1 and 2 in the sequence list as follows:

[0055] DENND2D-v1:

[0056] Upstream primer 5'CCAGAGATGGAAGGACAAGTG3'

[0057] Downstream primer 5'GTCATTCTTATTCACCACAGCTC3'

[0058] DENND2D-v2:

[0059] Upstream primer 5'CACTCCAGGGGCCATGGATG3'

[0060] Downstream primer 5'GTCATTCTTATTCACCACAGCTC3'

[0061] Using the above primers, the human normal lung tissue cDNA library (Clontech: K1420-1) was used as a template for PCR amplification reaction, and the reaction conditions were as follows:

[0062] The reaction volume is 50 μl, which contains:

[0063] Human normal lung tissue cDNA template 5μl (5ng)

[0064] Primers The final concentration of forward primer and reverse primer is 0.2 μM each

[0065] dNTP final concentration 200μM each

[...

Embodiment 2

[0072] Example 2, RT-PCR detection of the expression levels of DENND2D-v1 and DENND2D-v2 genes in lung cancer-related cell lines and lung cancer tissues

[0073] In order to detect the difference in the expression of DENND2D-v1 and DENND2D-v2 genes between tumor and normal tissue cells, this example extracted the total RNA of lung cancer-related cell lines, and used RT-PCR to detect the changes in mRNA transcription.

[0074] 1. Expression levels of DENND2D-v1 and DENND2D-v2 in lung cancer-related cell lines

[0075]Detect the following lung cancer related cell lines: PAa (human lung adenocarcinoma cell line), A549 (human lung adenocarcinoma cell line, ATCC, CCL-185), GLC-82 (human lung adenocarcinoma cell line), LTEP (human lung adenocarcinoma cell line), cancer cell line), H520 (human lung squamous cell line, ATCC, HTB-182), H2170 (human lung squamous cell line, ATCC, CRL-5928), PG (human lung large cell carcinoma cell line), H460 ( Human lung large cell carcinoma cell line...

Embodiment 3

[0110] Example 3. In order to detect the expression of DENND2D-v2 protein, Anti-DENND2D-v2 antibody was prepared

[0111] The GPA project team of Beijing Institute of Genomics, Chinese Academy of Sciences was entrusted to prepare and purify DENND2D-v2 polyclonal rabbit antibody, and the antigen used was purified GST-DENND2D fusion protein. Antibody specificity was identified by Western Blot method. The specific operation process is as follows:

[0112] 1. Expression of DENND2D-v2 protein

[0113]Using primers Sense: 5'CCGGAATTCATGGATGGGCTCGGCCGCC3' and Antisense: 5'CCGCTCGAGCGGTTATTCACCACAGCTCTTA3', use pcDB3.1-DENND2D-v2 as a template to PCR amplify the fragment containing sequence 2, respectively digest PCR products with EcoRI and XhoI (Promega) and express in prokaryotic Carrier PGEX-4T-1 (Amersham), recover the digested product, and connect to obtain the pGEX-DENND2D-v2 fusion protein expression vector containing the DENND2D-v2 gene (the N-terminus of the DENND2D-v2 prot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a tumour-related protein and its coding gene. The tumour-related protein is as follows: (a) a protein composed of sequence 4 amino acid residue in sequence list; (b) a protein derived from (a) by substituting and / or deleting and / or adding one or several amino acid residue of sequence 4 amino acid residue in sequence list The recombinant mammal gene expression vector containing tumour-related protein coding gene can be used as antineoplastic drug for preventing and / or treating lung cancer, esophageal carcinoma or cancer of larynx.

Description

technical field [0001] The invention relates to a tumor-associated protein and its coding gene and application. Background technique [0002] Tumor has become one of the major diseases that seriously threaten human survival and health, and its morbidity and mortality are on the rise. The discovery and study of differentially expressed genes in tumors helps to elucidate the molecular mechanism of tumorigenesis, contribute to the diagnosis and prognosis of tumors, and provide new targets for tumor treatment, thus becoming the basis of gene medicine and gene therapy. There are many ways to find differentially expressed genes. The high-throughput screening methods developed in recent years have injected new vitality into this research. In recent years, the research results of disease-related genes reported in the literature, a large part of them are high-throughput screening methods. The method was screened out and validated in the follow-up research. High-throughput methods m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12C12N15/63C07K16/18A61K48/00A61P35/00A61K38/17
Inventor 郑宏伟马大龙程书钧高燕宁袁劲松付国斌石太平
Owner CANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More