Human new gene LOC344967 correlated with nasopharyngeal carcinoma and coding protein product thereof
A nasopharyngeal carcinoma, amino acid technology, applied in the direction of anti-animal/human immunoglobulin, apoptosis-related protein, animal/human protein, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1: Genetic Analysis and Screening of LOC344967 and Nasopharyngeal Carcinoma
[0018] On the basis of the accumulated genetic evidence, using bioinformatics and molecular biology methods, based on the localization results of NPC susceptibility genes in the early stage, a position candidate cloning strategy was adopted to select genes in the 4p15.1-q12 region, and PCR-sequencing was used The method screened to detect sequence variations linked to familial nasopharyngeal carcinoma patients in the promoter region of LOC344967. This variation leads to the generation of AP-1 transcription factor binding site and the increased expression of LOC344967, which is linked to the susceptibility haplotype of nasopharyngeal carcinoma.
Embodiment 2
[0019] Embodiment 2: RT-PCR method clones LOC344967 gene
[0020] The total RNA extracted from nasopharyngeal carcinoma tissue was used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDNA, and then the following primers were used for PCR amplification:
[0021] Primer 1: 5'ATCAAAGAGGCGGGCGCCATCATC3' (SEQ ID NO.4)
[0022] Primer 2: 5'GGTGAAGACACTGGCGGCCC3' (SEQ ID NO.5)
[0023] Primer 1 is the forward sequence of base 501 at the 5' end of SEQ ID NO.1;
[0024] Primer 2 is the reverse complementary sequence of base 1231 located at the 5' end of SEQ ID NO.1
[0025] Amplification conditions: 50mmol / L KCl, 10mmol / L Tris-Cl (pH8.5), 1.5mmol / L MgCl in a 50uL reaction system 2 , 200umol / L dNTP, 10pmol primer, 1U of Teq DNA polymerase (Promega company product). On PE9600 type DNA thermal cycler (Perkin-Elmer Company), the reaction was carried out for 25 cycles according to the following conditions: 94°C for 30Sec; 58°C fo...
Embodiment 3
[0026] Example 3: RT-PCR analysis of the expression of LOC344967 in human tissues and cell lines
[0027] Total RNA from normal biopsy tissue samples and cells was amplified by RT-PCR. The tissues included liver, lung, kidney, brain, intestine and 2 cases of nasopharyngeal carcinoma tissues. The cells included NP69, C666-1, CNE1, CNE2, SUNE1 . PCR primers are SEQ ID NO.4 and SEQ ID NO.5. The result is shown in Figure 1.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 