Human new gene LOC344967 correlated with nasopharyngeal carcinoma and coding protein product thereof
A nasopharyngeal carcinoma, amino acid technology, applied in the direction of anti-animal/human immunoglobulin, apoptosis-related protein, animal/human protein, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1: Genetic Analysis and Screening of LOC344967 and Nasopharyngeal Carcinoma
[0018] On the basis of the accumulated genetic evidence, using bioinformatics and molecular biology methods, based on the localization results of NPC susceptibility genes in the early stage, a position candidate cloning strategy was adopted to select genes in the 4p15.1-q12 region, and PCR-sequencing was used The method screened to detect sequence variations linked to familial nasopharyngeal carcinoma patients in the promoter region of LOC344967. This variation leads to the generation of AP-1 transcription factor binding site and the increased expression of LOC344967, which is linked to the susceptibility haplotype of nasopharyngeal carcinoma.
Embodiment 2
[0019] Embodiment 2: RT-PCR method clones LOC344967 gene
[0020] The total RNA extracted from nasopharyngeal carcinoma tissue was used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDNA, and then the following primers were used for PCR amplification:
[0021] Primer 1: 5'ATCAAAGAGGCGGGCGCCATCATC3' (SEQ ID NO.4)
[0022] Primer 2: 5'GGTGAAGACACTGGCGGCCC3' (SEQ ID NO.5)
[0023] Primer 1 is the forward sequence of base 501 at the 5' end of SEQ ID NO.1;
[0024] Primer 2 is the reverse complementary sequence of base 1231 located at the 5' end of SEQ ID NO.1
[0025] Amplification conditions: 50mmol / L KCl, 10mmol / L Tris-Cl (pH8.5), 1.5mmol / L MgCl in a 50uL reaction system 2 , 200umol / L dNTP, 10pmol primer, 1U of Teq DNA polymerase (Promega company product). On PE9600 type DNA thermal cycler (Perkin-Elmer Company), the reaction was carried out for 25 cycles according to the following conditions: 94°C for 30Sec; 58°C fo...
Embodiment 3
[0026] Example 3: RT-PCR analysis of the expression of LOC344967 in human tissues and cell lines
[0027] Total RNA from normal biopsy tissue samples and cells was amplified by RT-PCR. The tissues included liver, lung, kidney, brain, intestine and 2 cases of nasopharyngeal carcinoma tissues. The cells included NP69, C666-1, CNE1, CNE2, SUNE1 . PCR primers are SEQ ID NO.4 and SEQ ID NO.5. The result is shown in Figure 1.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com