Unlock instant, AI-driven research and patent intelligence for your innovation.

Human new gene LOC344967 correlated with nasopharyngeal carcinoma and coding protein product thereof

A nasopharyngeal carcinoma, amino acid technology, applied in the direction of anti-animal/human immunoglobulin, apoptosis-related protein, animal/human protein, etc.

Inactive Publication Date: 2008-01-16
SUN YAT SEN UNIV CANCER CENT
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The functions of many acetyl-CoA hydrolases are unknown, and regulation of acyl-CoA accumulation by thioesterases in cells provides a mechanism for the regulation of fat metabolism

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human new gene LOC344967 correlated with nasopharyngeal carcinoma and coding protein product thereof
  • Human new gene LOC344967 correlated with nasopharyngeal carcinoma and coding protein product thereof
  • Human new gene LOC344967 correlated with nasopharyngeal carcinoma and coding protein product thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Genetic Analysis and Screening of LOC344967 and Nasopharyngeal Carcinoma

[0018] On the basis of the accumulated genetic evidence, using bioinformatics and molecular biology methods, based on the localization results of NPC susceptibility genes in the early stage, a position candidate cloning strategy was adopted to select genes in the 4p15.1-q12 region, and PCR-sequencing was used The method screened to detect sequence variations linked to familial nasopharyngeal carcinoma patients in the promoter region of LOC344967. This variation leads to the generation of AP-1 transcription factor binding site and the increased expression of LOC344967, which is linked to the susceptibility haplotype of nasopharyngeal carcinoma.

Embodiment 2

[0019] Embodiment 2: RT-PCR method clones LOC344967 gene

[0020] The total RNA extracted from nasopharyngeal carcinoma tissue was used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDNA, and then the following primers were used for PCR amplification:

[0021] Primer 1: 5'ATCAAAGAGGCGGGCGCCATCATC3' (SEQ ID NO.4)

[0022] Primer 2: 5'GGTGAAGACACTGGCGGCCC3' (SEQ ID NO.5)

[0023] Primer 1 is the forward sequence of base 501 at the 5' end of SEQ ID NO.1;

[0024] Primer 2 is the reverse complementary sequence of base 1231 located at the 5' end of SEQ ID NO.1

[0025] Amplification conditions: 50mmol / L KCl, 10mmol / L Tris-Cl (pH8.5), 1.5mmol / L MgCl in a 50uL reaction system 2 , 200umol / L dNTP, 10pmol primer, 1U of Teq DNA polymerase (Promega company product). On PE9600 type DNA thermal cycler (Perkin-Elmer Company), the reaction was carried out for 25 cycles according to the following conditions: 94°C for 30Sec; 58°C fo...

Embodiment 3

[0026] Example 3: RT-PCR analysis of the expression of LOC344967 in human tissues and cell lines

[0027] Total RNA from normal biopsy tissue samples and cells was amplified by RT-PCR. The tissues included liver, lung, kidney, brain, intestine and 2 cases of nasopharyngeal carcinoma tissues. The cells included NP69, C666-1, CNE1, CNE2, SUNE1 . PCR primers are SEQ ID NO.4 and SEQ ID NO.5. The result is shown in Figure 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a new human functional gene -LOC344967 which has close relationship with the occurrence and development of NPC. The gene is widely expressed in a plurality of human tissues, NPC biopsy samples and NPC cell line. The apoptosis will occur when the gene is highly expressed in NP69, C666-1, CNE-2, NPC cell line and other cells, which indicates that the gene has great biological function. Gene LOC344967 can be used as a new diagnosis and treatment target for NPC and other cancers.

Description

[technical field] [0001] The invention belongs to the field of biotechnology. Specifically, the invention describes the discovery, preparation and verification process of a new human gene LOC344967. [Background technique] [0002] Nasopharyngeal Carcinoma (NPC) is known as "Canton Tumor" because of its high incidence in Guangdong. It is also the highest. The remarkable regional and ethnic distribution of nasopharyngeal carcinoma has aroused strong interest of scholars at home and abroad, what is the reason for the high incidence of nasopharyngeal carcinoma in this region. Researchers at home and abroad try to explain this phenomenon with newly developed technologies and new theories. [0003] In 2002, our research group located the NPC susceptibility gene in the 4p15.1-q12 region, and then further fine-tuned the region to narrow it down to D4S2950 to D4S3347, with a genetic map distance of 8.29cM, corresponding to the region between 4p15.1-4p11 During the period, the resu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/63C07K16/18A61K48/00C12Q1/68A61P35/00
CPCC07K14/4747C12Q2600/158C12Q1/6886A61P35/00
Inventor 曾益新
Owner SUN YAT SEN UNIV CANCER CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More