Small interfering RNA recombinant adenovirus for targeting epidermal growth factor receptor and use thereof

A technology of epidermal growth factor and RNA recombination, applied in the biological field, can solve the problems of high price, low efficiency, and low transfection efficiency, and achieve the effect of improving the efficiency of introduction and prolonging the time

Inactive Publication Date: 2008-07-23
ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are problems such as low effective rate, no superiority in prolonging patient survival, high price, low transfection efficiency, and unstable expression of tumor biotherapy methods targeting EGFR. sexual progress

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small interfering RNA recombinant adenovirus for targeting epidermal growth factor receptor and use thereof
  • Small interfering RNA recombinant adenovirus for targeting epidermal growth factor receptor and use thereof
  • Small interfering RNA recombinant adenovirus for targeting epidermal growth factor receptor and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Construction and Identification of Small Interfering RNA Shuttle Vectors Targeting EGFR

[0034] Design and synthesis of small interfering RNA DNA expression template:

[0035] 5'-TCGAGGGAGCTGCCCATGAGAAATTTCAAGAGAATTTCTCATGGGCAGCTCCTT A-3'

[0036] 3'-CCCTCGACGGGTACTCTTTTAAAGTTCTCTTAAAGAGTACCCGTCGAGGAA TGATC-5'

[0037] The above oligonucleotides are annealed to form a double-stranded structure, and the annealing reaction system is established as follows:

[0038] Sense strand 2μl

[0039] Antisense strand 2μl

[0040] 1×DNA mimic solution 46μl

[0041] Incubate at 95°C for 5 minutes, at 72°C for 10 minutes, then slowly lower to 37°C for 1 hour;

[0042] Take 5 μl of the annealing solution in the previous step and add 45 μl of deionized water, the final concentration is 8 ng / μl;

[0043] Expression template and shuttle vector ligation reaction:

[0044] pShEGFR reaction system addition amount

[0045] Deionized water 11.25μl

[0046] EGFR expression t...

Embodiment 2

[0062] Recombination and identification of embodiment 2 adenovirus

[0063] Linearization of shuttle vectors and backbone vectors:

[0064] Reaction system Adding amount (μl)

[0065] Shuttle Carrier 1.0

[0066] Pac I 2.0

[0067] 10× buffer 5.0

[0068] 10×Bovine Serum Albumin 5.0

[0069] Deionized water Make up volume to 50.0μl

[0070] 37°C water bath for 1.5 hours;

[0071] Reaction system Adding amount (μl)

[0072] Lac Z Backbone Vector 8.0

[0073] Pac I 2.0

[0074] 10× Buffer 2.0

[0075] 10×Bovine Serum Albumin 2.0

[0076] Deionized water Make up volume to 20.0μl

[0077] 37°C water bath for 1.5 hours;

[0078] The linearized shuttle vector and the backbone vector were co-transfected into 293 cells by the calcium phosphate method, and homologous recombination occurred to obtain EGFR-targeted small interfering RNA recombinant adenovirus.

[0079] Amplification of recombinant adenovirus:

[0080] A, 10ml 10% fetal bovine serum / DMEM culture 5×10 6 293...

Embodiment 3

[0119] Example 3 Determination of Recombinant Adenovirus Infection Efficiency

[0120] 1. Cell Preparation: Take 5 x 10 5 Inoculate human lung adenocarcinoma cells A549 into a 6-well plate at a density of 6 wells, and the confluence rate will reach about 50% the next day;

[0121] 2. Use recombinant adenovirus (diluted with medium containing 2% fetal bovine serum) and cells with multiplicity of infection (MOI) of 10, 20, 30, 50, 100 respectively;

[0122] 3. Cultivate in a 37°C, 5% CO2 cell incubator for 4-8 hours, remove the supernatant, and add conventional medium to continue culturing for 48-72 hours;

[0123] 4. Remove the medium and rinse with PBS;

[0124] 5. Remove PBS, fix with 0.25% glutaraldehyde at room temperature for 15 minutes;

[0125] 6. Remove the fixative, rinse with PBS for 3×5 minutes;

[0126] 7. Use the β-galactosidase in situ staining kit for X-gal staining.

[0127] a. Preparation of dyeing working solution

[0128] β-galactosidase staining soluti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Upstream primeraaaaaaaaaa
Login to View More

Abstract

The invention relates to a small interference RNA recombinant adenovirus of a targeted epidermal growth factor receptor and the role the recombinant adenovirus plays in inhibiting the in vivo growth of the human lung adenocarcinoma cell, belonging to the technical field of biotechnique. The small interference RNA recombinant adenovirus adopts the technical proposal that: an adenovirus vector system is used to construct a shuttle vector and a backbone vector, so as to conduct homologous recombination in a packaging cell 293 and obtain the replication-deficient recombinant adenovirus. By giving specific attention to the difficulties of lung cancer treatment and gene regulation technique, the small interference RNA recombinant adenovirus constructs the expression vector of the small interference RNA virus; therefore, the small interference RNA recombinant adenovirus of a targeted epidermal growth factor receptor has the advantages of improving the introduction efficiency of the small interference RNA, and prolonging the time of the RNA interference effects. Moreover, the experiments done in animal body prove that: the small interference RNA recombinant adenovirus can generate RNA interference effect, down-regulate the EGFR expressions, and inhibit the growth of the tumor.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a recombinant adenovirus, in particular to a small interfering RNA recombinant adenovirus targeting epidermal growth factor receptor and its function in inhibiting the growth of human lung adenocarcinoma cells in vivo. Background technique [0002] Epidermal growth factor receptor (EGFR) binds with ligands to form a complex, causing a series of biological effects, promoting epithelial regeneration, and stimulating the division of various cells in the body. The amplification of EGFR gene and the overexpression of its products are closely related to the occurrence of human tumors, and there is overexpression of EGFR in many human tumors. EGFR overexpression is closely related to the malignancy, metastasis, sensitivity to radiotherapy and chemotherapy, and prognosis of lung cancer. Blocking the EGFR pathway can effectively inhibit tumor growth, indicating that EGFR is a very promi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N7/01C12N15/64A61K48/00A61K35/76A61P35/00A61K35/761
Inventor白春学张新白莉祝蓉
OwnerZHONGSHAN HOSPITAL FUDAN UNIV