Small interfering RNA recombinant adenovirus for targeting epidermal growth factor receptor and use thereof
A technology of epidermal growth factor and RNA recombination, applied in the biological field, can solve the problems of high price, low efficiency, and low transfection efficiency, and achieve the effect of improving the efficiency of introduction and prolonging the time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Construction and Identification of Small Interfering RNA Shuttle Vectors Targeting EGFR
[0034] Design and synthesis of small interfering RNA DNA expression template:
[0035] 5'-TCGAGGGAGCTGCCCATGAGAAATTTCAAGAGAATTTCTCATGGGCAGCTCCTT A-3'
[0036] 3'-CCCTCGACGGGTACTCTTTTAAAGTTCTCTTAAAGAGTACCCGTCGAGGAA TGATC-5'
[0037] The above oligonucleotides are annealed to form a double-stranded structure, and the annealing reaction system is established as follows:
[0038] Sense strand 2μl
[0039] Antisense strand 2μl
[0040] 1×DNA mimic solution 46μl
[0041] Incubate at 95°C for 5 minutes, at 72°C for 10 minutes, then slowly lower to 37°C for 1 hour;
[0042] Take 5 μl of the annealing solution in the previous step and add 45 μl of deionized water, the final concentration is 8 ng / μl;
[0043] Expression template and shuttle vector ligation reaction:
[0044] pShEGFR reaction system addition amount
[0045] Deionized water 11.25μl
[0046] EGFR expression t...
Embodiment 2
[0062] Recombination and identification of embodiment 2 adenovirus
[0063] Linearization of shuttle vectors and backbone vectors:
[0064] Reaction system Adding amount (μl)
[0065] Shuttle Carrier 1.0
[0066] Pac I 2.0
[0067] 10× buffer 5.0
[0068] 10×Bovine Serum Albumin 5.0
[0069] Deionized water Make up volume to 50.0μl
[0070] 37°C water bath for 1.5 hours;
[0071] Reaction system Adding amount (μl)
[0072] Lac Z Backbone Vector 8.0
[0073] Pac I 2.0
[0074] 10× Buffer 2.0
[0075] 10×Bovine Serum Albumin 2.0
[0076] Deionized water Make up volume to 20.0μl
[0077] 37°C water bath for 1.5 hours;
[0078] The linearized shuttle vector and the backbone vector were co-transfected into 293 cells by the calcium phosphate method, and homologous recombination occurred to obtain EGFR-targeted small interfering RNA recombinant adenovirus.
[0079] Amplification of recombinant adenovirus:
[0080] A, 10ml 10% fetal bovine serum / DMEM culture 5×10 6 293...
Embodiment 3
[0119] Example 3 Determination of Recombinant Adenovirus Infection Efficiency
[0120] 1. Cell Preparation: Take 5 x 10 5 Inoculate human lung adenocarcinoma cells A549 into a 6-well plate at a density of 6 wells, and the confluence rate will reach about 50% the next day;
[0121] 2. Use recombinant adenovirus (diluted with medium containing 2% fetal bovine serum) and cells with multiplicity of infection (MOI) of 10, 20, 30, 50, 100 respectively;
[0122] 3. Cultivate in a 37°C, 5% CO2 cell incubator for 4-8 hours, remove the supernatant, and add conventional medium to continue culturing for 48-72 hours;
[0123] 4. Remove the medium and rinse with PBS;
[0124] 5. Remove PBS, fix with 0.25% glutaraldehyde at room temperature for 15 minutes;
[0125] 6. Remove the fixative, rinse with PBS for 3×5 minutes;
[0126] 7. Use the β-galactosidase in situ staining kit for X-gal staining.
[0127] a. Preparation of dyeing working solution
[0128] β-galactosidase staining soluti...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Upstream primer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
