Preparation and detection method of jejunum vibrio coli rapid detection reagent kit

A detection kit and technology for Campylobacter, which is applied in biochemical equipment and methods, microbial measurement/testing, and resistance to vector-borne diseases. It can solve the problems of time-consuming, cumbersome, and unreliable biochemical identification results, and achieve high sensitivity. , strong specific effect

Inactive Publication Date: 2008-09-03
INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF0 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Campylobacter jejuni mainly causes acute enteritis and food poisoning in humans, and has replaced Salmonella as one of the most common diarrheal disease pathogens in developed countries. Easily enters a non-culturable but viable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0033] Example 1

[0034] The loop-mediated isothermal amplification kit of Campylobacter jejuni coli was prepared according to the following formula:

[0035] (1) LAMP reaction solution:

[0036] Contains 2.5μL 10×Thermopol reaction buffer, 1.0μL 10mmol / L dNTP, 1.0μL 20μmol / L upstream internal primer (FIP), 1.0μL 20μmol / L downstream internal primer (BIP), 0.25μL 20μmol / L upstream external primer ( F3), 0.25μL 20μmol / L downstream external primer (B3), 0.5μL 100mmol / L MgSO 4 , 12.5μL 2mol / L betaine and 4μL ddH 2 O.

[0037] The upstream inner primer:

[0038] 5-ACAGCTATACCACTTGAACCATTTA-AAGTGAACCTGATGTTTTACCT-3,

[0039] Downstream inner primer:

[0040] 5-ACAAACATCCCGCCTCATAGTTTAA-TCTCTTCTAAGCTTGCATCT-3,

[0041] Upstream outer primer: 5-TTCCAAATTATGATGGTTCAGA-3,

[0042] Downstream outer primer: 5-TGGACCTTTAATAAACTGCATAA-3

[0043] The mass ratio of the four kinds of deoxyribonucleic acids in the mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.

[0044] (2) UNG enzyme: 1U / μL;

[0045] ...

Example Embodiment

[0058] Example 2

[0059] The following formula is used to make a loop-mediated isothermal amplification kit for Campylobacter jejuni:

[0060] (1) LAMP reaction solution:

[0061] Contains 2.5μL 10×Thermopol reaction buffer, 1.0μL 10mmol / L dNTP, 1.0μL 20μmol / L upstream internal primer (FIP), 1.0μL 20μmol / L downstream internal primer (BIP), 0.25μL 20μmol / L upstream external primer ( F3), 0.25μL 20μmol / L downstream external primer (B3), 0.5μL 100mmol / L MgSO 4 , 12.5μL 2mol / L betaine and 4μL ddH 2 O.

[0062] The upstream inner primer, downstream inner primer, upstream outer primer and downstream outer primer are the same as above.

[0063] The mass ratio of the four kinds of deoxyribonucleic acids in the mixture dNTP is dUTP:dAP:dGTP:dCTP=2:1:1:1.

[0064] (2) UNG enzyme: 1U / μL;

[0065] (3) Bst DNA polymerase: 8U / μL;

[0066] (4) Chromogenic agent C: 10% fluorescent dye SYBR GREEN I or DNAGreen.

[0067] Follow the following (1)-(3) procedures for testing:

[0068] (1) Extraction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for preparing a reagent kit for fast detecting campylobacter jejuni and campylobacter coli and a method for detecting campylobacter jejuni and campylobacter coli by loop mediate disothermal amplification technology. The reagent kit contains loop mediate disothermal amplification reaction liquid, Bst DNA polymerase and developer; the reaction liquid consists of reaction buffer liquid, dNTP, bitter salt, upstream inner primer 5- ACAGCTATACCACTTGAACCATTTAAAGTGAACCTGA TGTTTTACCT-3, downstream inner primer 5-ACAAACATCCCGCCTCATAGTTTAAT CTCTTCTAAGCTTGCATCT-3, upstream outer primer 5-TTCCAAATTATG ATGGTTCAGA-3, downstream outer primer 5-TGGACCTTTAATAAACTGCATAA-3 and lycine; the method for detecting campylobacter jejuni and campylobacter coli comprises the steps of: extracting bacterial DNA, loop mediate disothermal amplifying of the campylobacter jejuni and campylobacter coli, and development detecting. The invention has the following advantages, including high speed, strong specificity, high sensitivity and low cost.

Description

technical field [0001] The invention relates to a method for rapid detection of bacterial samples by using a loop-mediated isothermal amplification (LAMP) technology, in particular to a preparation and detection method of a rapid detection kit for campylobacter jejuni and coli. Background technique [0002] Campylobacter jejuni (Campylobacter jejuni) is a kind of comma-shaped or S-shaped Gram-negative bacillus, which is a common zoonotic pathogen. The bacterium can cause diarrhea in animals and enteritis in humans, and a variety of animals carry this bacterium. The bacterium is widely distributed and has been detected from the intestines and excrement of cattle, cats, dogs, rabbits, pigs and other mammals and in vitro. The main route of transmission of the disease is the digestive tract. Campylobacter jejuni is an opportunistic pathogen, which can cause the disease in cold weather, poor feeding and management, and reduced resistance of cattle. Infection can not only cause ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/10C12Q1/68
CPCY02A50/30
Inventor 高宏伟昃向君陈颖雷质文林超
Owner INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap