Recombinant clostridium and construction method and use thereof
A technology of Clostridium acetobutylicum and SMB-1, which is applied in the fields of application, botany equipment and methods, and microbial-based methods, and can solve problems such as not having the ability to compete with chemical synthesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1, construct the Clostridium acetobutylicum expressing formate dehydrogenase
[0036] Formate dehydrogenase was amplified from the genome of Candida boidinii 2.2160 (China Common Microorganism Culture Collection Center) (http: / / www.cgmcc.net / index.php / Contents / search) genome (fdh), the primers for amplifying the fdh gene are as follows:
[0037] fdh-A: AGTGTCGACAGGTGCTGTCAATGTGGT;
[0038] fdh-B: AGTGGATCCGTGCTCCCGTCATTATCT.
[0039]The PCR amplification product was connected to the expression vector pIMP1 (Mermelstein, L.D., N.E.Welker, G.N.Bennett, and E.T.Papoutsakis.(1992).Expression of cloned homologousfermentative genes in Clostridium acetobutylicum ATCC 824.Bio / Technology.10:190-195) ( On the Institute of Microbiology, Chinese Academy of Sciences), the recombinant expression vector pITF ( figure 1 ), sequence verification after connection transformation, and the sequencing results showed that the nucleotide sequence of the PCR product of the amplifi...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap