Molecular marker ISG15 related to pig immune and reproductive traits
A technique for molecular markers and pig reproduction, which is applied in the determination/testing of microorganisms, animal/human peptides, biochemical equipment and methods, etc., and can solve problems such as immune suppression in pigs, stillbirths, and mummified fetuses
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] (1) CDS cloning of porcine ISG15 gene
[0020] Use the human ISG15 gene mRNA (GenBank accession number: NM_005101.2) as the information probe, use the BLAST tool in the NCBI website to scan the GenBank porcine expressed sequence tag database, and the porcine expressed sequence with a homology greater than 70% and a fragment length greater than 100bp All the tags were downloaded to the computer, and then the expressed sequence tags of the porcine ISG15 gene were spliced into expressed sequence tags-contigs using the SeqMan program in the biological software DNAStar. According to the homologous comparison with the human ISG15 gene mRNA, the start and stop codon positions were preliminarily determined. Using the biological primer design software Primer Premier 5.0, the spliced expressed sequence tag-contig was used as the template sequence for primer design to design primers. The sequence is as follows:
[0021] ISG15 forward primer ATGGGTAGGGAACTGAAGGTG (this primer ...
Embodiment 2
[0045] Example 2: Application of the molecular marker prepared by the present invention in the detection of polymorphisms in different pig populations
[0046] PCR-HindIII-RFLP was used to detect 6 pig breeds with different Chinese and foreign ancestry, among which the pig breeds with foreign ancestry were Large White and Duroc, and the pigs with Chinese local ancestry were Qingping pig and Meishan pig , Big White Pig and Tongcheng Pig. The genotype and gene frequency of the mutation site in different pig breeds are shown in Table 1. The test results showed that all genotypes of the ISG15 gene were distributed in Large White pigs, Tongcheng pigs and Duroc pigs. The distribution of GG and AG genotypes was not detected in Dahua white pigs, and the distribution of GG genotypes was not detected in Meishan pigs and Qingping pigs, showing gene monomorphism. The results indicated that allele A of ISG15 gene was dominant in Chinese pig breeds, and the allele frequencies were 95%, 100...
Embodiment 3
[0052] Example 3: Association analysis of molecular markers prepared in the present invention and immune traits
[0053] The pigs in this example come from the Landrace pigs of the Shuitai original breeding pig farm of Guangdong Huanong Wen's Animal Husbandry Co., Ltd., the parents and offspring were all genotype tested, and the offspring were collected at 0, 17, and 32 days old. Coagulation and non-anticoagulant blood, used for blood routine and antibody level detection.
[0054] The traits analyzed are mainly immune traits, including: porcine reproductive and respiratory syndrome (PRRS) virus antibody levels, swine fever virus antibody levels, pseudorabies antibody levels in the first generation of pigs at 0, 17, and 32 days of age respectively blood levels and 18 indicators of blood routine. According to the population structure of the collected samples, the applicant used a mixed model to statistically analyze the genotype effect of the SNP site of the ISG15 gene and its ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 