Check patentability & draft patents in minutes with Patsnap Eureka AI!

Molecular marker ISG15 related to pig immune and reproductive traits

A technique for molecular markers and pig reproduction, which is applied in the determination/testing of microorganisms, animal/human peptides, biochemical equipment and methods, etc., and can solve problems such as immune suppression in pigs, stillbirths, and mummified fetuses

Active Publication Date: 2015-03-18
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In my country, PRRS broke out in a small number of pig farms in 1995, and then it spread rapidly across the country. It has become an important threat to pigs in my country. On the one hand, PRRSV causes abortion, stillbirth, and mummified fetuses in sows. It is also a porcine respiratory disease syndrome. (PRDC) is an important primary pathogen that can also cause immunosuppression in pigs, and there is currently no particularly effective means of prevention and control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker ISG15 related to pig immune and reproductive traits
  • Molecular marker ISG15 related to pig immune and reproductive traits
  • Molecular marker ISG15 related to pig immune and reproductive traits

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] (1) CDS cloning of porcine ISG15 gene

[0020] Use the human ISG15 gene mRNA (GenBank accession number: NM_005101.2) as the information probe, use the BLAST tool in the NCBI website to scan the GenBank porcine expressed sequence tag database, and the porcine expressed sequence with a homology greater than 70% and a fragment length greater than 100bp All the tags were downloaded to the computer, and then the expressed sequence tags of the porcine ISG15 gene were spliced ​​into expressed sequence tags-contigs using the SeqMan program in the biological software DNAStar. According to the homologous comparison with the human ISG15 gene mRNA, the start and stop codon positions were preliminarily determined. Using the biological primer design software Primer Premier 5.0, the spliced ​​expressed sequence tag-contig was used as the template sequence for primer design to design primers. The sequence is as follows:

[0021] ISG15 forward primer ATGGGTAGGGAACTGAAGGTG (this primer ...

Embodiment 2

[0045] Example 2: Application of the molecular marker prepared by the present invention in the detection of polymorphisms in different pig populations

[0046] PCR-HindIII-RFLP was used to detect 6 pig breeds with different Chinese and foreign ancestry, among which the pig breeds with foreign ancestry were Large White and Duroc, and the pigs with Chinese local ancestry were Qingping pig and Meishan pig , Big White Pig and Tongcheng Pig. The genotype and gene frequency of the mutation site in different pig breeds are shown in Table 1. The test results showed that all genotypes of the ISG15 gene were distributed in Large White pigs, Tongcheng pigs and Duroc pigs. The distribution of GG and AG genotypes was not detected in Dahua white pigs, and the distribution of GG genotypes was not detected in Meishan pigs and Qingping pigs, showing gene monomorphism. The results indicated that allele A of ISG15 gene was dominant in Chinese pig breeds, and the allele frequencies were 95%, 100...

Embodiment 3

[0052] Example 3: Association analysis of molecular markers prepared in the present invention and immune traits

[0053] The pigs in this example come from the Landrace pigs of the Shuitai original breeding pig farm of Guangdong Huanong Wen's Animal Husbandry Co., Ltd., the parents and offspring were all genotype tested, and the offspring were collected at 0, 17, and 32 days old. Coagulation and non-anticoagulant blood, used for blood routine and antibody level detection.

[0054] The traits analyzed are mainly immune traits, including: porcine reproductive and respiratory syndrome (PRRS) virus antibody levels, swine fever virus antibody levels, pseudorabies antibody levels in the first generation of pigs at 0, 17, and 32 days of age respectively blood levels and 18 indicators of blood routine. According to the population structure of the collected samples, the applicant used a mixed model to statistically analyze the genotype effect of the SNP site of the ISG15 gene and its ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of the livestock genetic engineering, and particularly relates to the molecular mark used as auxiliary choice of pig marks and relating to immunity and reproductive trait and application thereof. The molecular mark is obtained from ISG15 gene clone, and the cDNA sequence thereof is described in a sequence list SEQ ID NO: 1. A base mutation of A390-G390 exists in a 390bp place of the sequence list SEQ ID NO: 1, thereby resulting in the HindIII-RFLP polymorphism. The invention also discloses the primers used by the HindIII-RFLP polymorphism and a polymorphism detection method, and provides a new molecular mark for the auxiliary choice of pig marks.

Description

technical field [0001] The invention belongs to the field of porcine molecular marker preparation, and in particular relates to the preparation and application of a molecular marker related to immune and reproductive traits used as pig marker-assisted selection. Background technique [0002] For a long time, increasing litter size and enhancing disease resistance have been the main goals of pig breeding. my country is the largest country in pig production and pork consumption. The prominent problem faced by the pig industry is the impact of diseases. So far, a series of problems such as the death of pigs and the reduction of reproductive efficiency caused by the virus have brought significant losses to pig production. However, the traditional disease control methods have long plagued people with the problems of enhanced drug resistance of pathogenic microorganisms, drug residues and inability to cure the root cause. Therefore, in the long run, the use of genetic methods to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/12C12N15/10C07K4/12
Inventor 余梅黄江南赵书红朱猛进李长春李新云
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More