Check patentability & draft patents in minutes with Patsnap Eureka AI!

Tumor target and recombined human Fas ligand fusion protein and preparation method thereof

A tumor-targeting, fusion protein technology, applied in the field of tumor-targeting and recombinant human Fas ligand fusion protein and its preparation, can solve the problem of lack of specific affinity for tumors

Inactive Publication Date: 2009-11-11
XIAMEN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cytotoxic drugs are used through traditional injection routes. The drugs are evenly distributed in the systemic circulation and lack specific affinity for tumors. The drug reaches the tumor site

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor target and recombined human Fas ligand fusion protein and preparation method thereof
  • Tumor target and recombined human Fas ligand fusion protein and preparation method thereof
  • Tumor target and recombined human Fas ligand fusion protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0051] The following embodiments will further illustrate the present invention in conjunction with the accompanying drawings.

[0052] 1) Design primers:

[0053] The complete sequence of human Fas ligand cDNA was obtained from GenBank, and arginine-lysine-arginine (Arg-Lys-Arg) was added to its N-terminus through a Linker to obtain a tumor-targeting specific binding polypeptide and The original gene sequence of recombinant human Fas ligand fusion protein (RGD-rhFasL):

[0054] GGCTGCGATTGTCGCGGAGATTGCTTCTGCAAGCTTATGCAGCAGCCCTTCAATTACCC , where the part with a horizontal line represents the tumor-targeting specific binding polypeptide sequence; according to the codon degeneracy and the codon preference principle of E. The nucleotide sequence of the recombinant human Fas ligand fusion protein (RGD-rhFasL) is modified to:

[0055] GGCTGCGATTGTCGCGGAGATTGCTTCTGCAAGCTTATGCAGCAGCCCTTCAATTACCC CAGCAGCCCTTCAATTACCCATATCC G CAGATCTACTGGGTGGACAGCAGTGC G AGC AG TCCCTGGGCCCCTCCAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Tumor target and recombined human Fas ligand fusion protein and a preparation method thereof relate to a gene and provide construction, expression and purification of tumor target specific binding peptide and recombined human Fas ligand fusion protein gene as well as in vitro and vivo biology activity identification method. Fas ligand cDNA complete sequence is searched from GenBank, Arg-Lys-Arg is added by Linker(YNFPQQMLKCFC) at terminal N of the complete sequence to obtain original gene sequence for coding the tumor target specific binding peptide and recombined human Fas ligand fusion protein; nucleotide sequence of the tumor target specific binding peptide and recombined human Fas ligand fusion protein is modified according to degeneracy of codon and codon preference principle of colon bacillus; the modified fusion protein sequence is divided into twelve long primer segments, and BamH I and Xho I enzyme restriction sites are introduced; and the fusion protein gene is obtained by PCR reaction.

Description

technical field [0001] The present invention relates to a technology of gene cloning, expression of exogenous gene in prokaryotic cells, purification of target protein, in vivo and in vitro activity identification of tumor-targeting specific binding polypeptide and recombinant human Fas ligand fusion protein (RGD-rhFasL), etc. , especially relates to a tumor targeting specific binding polypeptide and recombinant human Fas ligand fusion protein (RGD-rhFasL) and its preparation, tumor targeting specific binding polypeptide and recombinant human Fas ligand fusion protein (RGD-rhFasL) as An antitumor drug that can target and specifically act on tumor cells. Background technique [0002] 1) Fas / FasL system and its induction of apoptosis [0003] Fas ligand (Fas ligand, FasL) has a total length of 278 amino acids and is a type II transmembrane glycoprotein consisting of an extracellular region, a transmembrane region and a cytoplasmic region. The 150 amino acids at the N-termina...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12P19/34A61P35/00
Inventor 庄国洪李文珠王娟苟立新
Owner XIAMEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More