Unlock instant, AI-driven research and patent intelligence for your innovation.

Pre-T carrier used for preparing eukaryon expression constructing body and preparation method and application thereof

A technology for eukaryotic expression vectors and expression constructs, which is applied to the preparation of pre-T vectors for eukaryotic expression constructs and the field of preparation thereof. It can solve the problems of difficult primers, low expression efficiency of target fragments, and cloning of PCR products, etc., to improve expression Efficiency and ease of primer design

Inactive Publication Date: 2010-01-20
INST OF AQUATIC LIFE ACAD SINICA
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this vector cannot directly clone PCR products; when designing PCR primers for insert fragments, it is difficult to design high-quality primers if the double-digestion site and Kozak sequence are not considered. Then it may lead to low expression efficiency of the target fragment
This makes the use of existing eukaryotic expression vectors to prepare eukaryotic expression constructs with many steps and low efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pre-T carrier used for preparing eukaryon expression constructing body and preparation method and application thereof
  • Pre-T carrier used for preparing eukaryon expression constructing body and preparation method and application thereof
  • Pre-T carrier used for preparing eukaryon expression constructing body and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0048] The present invention will be further described below in conjunction with the accompanying drawings and the examples of preparing the target protein-myc-His tag fusion protein expression construct.

[0049] 1) Put pcDNA3.1(-) / myc-his A( figure 1 ) was double digested with EcoRI and KpnI.

[0050] 2) design such a pair of primers ( figure 2 )TANQ-F: AGAATTCGCCACCATGGCTCAATTGGCGTCCACCCGCGAGC and TANQ-R: TGGTACCAACTATTGTTTGGCAAGTTAGGTTTTGTC, the characteristics of this pair of primers are: the forward primer has a start codon ATG, with the A of ATG as the coordinate, its upstream base is expressed as -1 in sequence, -2, -3..., the downstream bases are sequentially expressed as +1, +2, +3...; from -2 to +12 is an XcmI restriction site, its sequence is CCATGGCT / CAATTGG, cut with XcmI After that, it can form a 3'T sticky end; from -6 to +4 is a Kozak sequence; from -12 to -7 is an EcoRI restriction site; the reverse primer contains an XcmI restriction site in turn and Kpn...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pre-T carrier used for preparing eukaryon expression constructing body and a preparation method and an application thereof, relating to the technical field of T carrier preparation. The current pre-T carrier introduces Kozak sequence and XcmI box or AhdI box into current plasmid eukaryon expression carrier, utilizes XcmI enzyme digestion or AhdI enzyme digestion to form a T carrier, and utilizes the T carrier to directly clone PCR product. The preparation method of the current pre-T carrier is as follows: (1) preparing a universal insertion sequence of eukaryon expression carrier containing Kozak sequence and XcmI box; and (2) preparing the eukaryon expression pre-T carrier. The pre-T carrier in the invention exists in the form of plasmid and can be obtained continuously by the amplification of bacteria; the pre-T carrier can be used for directly cloning PCR product, thus simplifying the double enzyme digestion process on the PCR product and the carrier; the design of primer is more simple and convenient; the expression efficiency of the exogenous protein can be improved; the invention is applicable to preparing various eukaryon expression constructing bodies rapidly by the method of TA cloning.

Description

technical field [0001] The invention relates to the technical field of T vector preparation, in particular to a pre-T vector for preparing eukaryotic expression constructs, a preparation method and application thereof. Background technique [0002] At present, the most commonly used expression vector for preparing eukaryotic expression constructs is generally a plasmid with a strong promoter and multiple cloning sites, and a linear vector is obtained by double enzyme digestion, so this vector has the advantage of being permanently used once. However, this vector cannot directly clone PCR products; when designing PCR primers for insert fragments, it is difficult to design high-quality primers if the double-digestion site and Kozak sequence are not considered. Then it may lead to low expression efficiency of the target fragment. This makes the use of existing eukaryotic expression vectors to prepare eukaryotic expression constructs more steps and inefficient. Contents of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/79
Inventor 刘庭凯桂建芳张义兵蒋芳芳
Owner INST OF AQUATIC LIFE ACAD SINICA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More