Unlock instant, AI-driven research and patent intelligence for your innovation.

Multi-target-spot siRNA recombinant slow virus carrier for acquired immune deficiency syndrome gene therapy

A recombinant lentivirus, multi-target technology, applied in gene therapy, antiviral agents, genetic engineering, etc., to achieve effective HIV replication, delay virus escape, and inhibit HIV replication

Inactive Publication Date: 2012-05-09
WUHAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method of interference is only effective in the short term

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-target-spot siRNA recombinant slow virus carrier for acquired immune deficiency syndrome gene therapy
  • Multi-target-spot siRNA recombinant slow virus carrier for acquired immune deficiency syndrome gene therapy
  • Multi-target-spot siRNA recombinant slow virus carrier for acquired immune deficiency syndrome gene therapy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Conservative Analysis of siRNA Target Sequences Targeting HIV Genes

[0058] In order to clarify the conservation of the siRNA target sequence selected by the applicant in the main epidemic strains of HIV in China, the applicant applied the Primalign software in the Los Alamos HIV Sequence Database (http: / / www.hiv.lanl.gov / content / sequence / QUICK_ALIGN / QuickAlign.html) conducted sequence conservation analysis on the selected 4 siRNA targets including rev, gag, pol, and tat ( figure 1 ). The analysis results showed that among the above four analysis objects, the conservation of tat siRNA target sequence was the highest among different HIV strains.

[0059] The siRNA target sequence selected in this embodiment is as follows (the CCR5 target sequence is attached in this table):

[0060] target gene Target sequence (5'--3') Length (bp) references Rev. ACTTACTCTTTGATTGTAAC 19 Arteaga et al., 2003 Gag GTAGCAACTCTTCTATTGTGTA ...

Embodiment 2

[0061] Example 2: Construction of siRNA recombinant lentiviral vector

[0062] 2.1 Transformation of lentiviral vector pLentiLox 3.7

[0063] The lentiviral vector modified by the applicant is pLentiLox 3.7 (Rubinson and Dillon, Nature Genetics, 2003). The vector contains a mouse U6 promoter to control the expression of siRNA, and also contains a reporter gene EGFP for flow cytometry sorting. In order to make the lentiviral vector more suitable for human-related experimental research (such as research on AIDS gene therapy), and to avoid homologous recombination caused by a single promoter of the tandem siRNA and the loss of the siRNA expression box, the applicant added the The murine U6 promoter of the vector was replaced with the human U6 promoter and the human H1 promoter respectively (the human U6 promoter and the human H1 promoter were obtained from Ambion’s products pSilencer2.0_U6 and pSilencer3.0_H1 by PCR), after transformation The lentiviral vectors were named pLLU6...

Embodiment 3

[0093] Example 3: Inhibitory Ability of siRNA Recombinant Lentiviral Vectors to HIV Replication

[0094] pNL4-3.Luc.R-E-(Landau NR, Viology, 1995) was transformed on the basis of HIV full-length clone pNL4-3: Firefly luciferase gene (LucF) was inserted into nef gene, 2 frameshifts Mutations resulted in deletion of Env and Vpr in this clone.

[0095] The applicant co-transfected HEK-293T cells with the above siRNA recombinant lentiviral vectors and pNL4-3.Luc.R-E- and pRL-TK (Renilla luciferase expression plasmid, purchased from Promega), and detected the relative fluorescence after 24 hours Sulfase activity, the results are as follows image 3 As shown (Note: pNL4-3.Luc.R-E-replication level can be represented by Firefly luciferase activity; Renilla luciferase activity value is used as an internal reference; NC is a negative control). The results show that each siRNA recombinant lentiviral vector has different degrees of inhibitory effect on HIV replication, and the combined...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multi-target-spot siRNA recombinant slow virus carrier for acquired immune deficiency syndrome gene therapy. 12 siRNA recombinant slow virus carriers of single target spot, double target spots and three target spots are constructed by aiming at acquired immune deficiency syndrome virus conservative genes (pol, rev and tat) and an acquired immune deficiency syndrome virus auxiliary receptor (CCR5) as target spots, and a most effective siRNA recombinant slow virus carrier: pLLH1 CCR5_U6 rev_U6 tat(Escherichia coli Stb13 / pLLH1 CCR5_U6 rev_U6 tat CCTCC M 209137) is screened out from the 12 siRNA recombinant slow virus carriers. The carrier is the siRNA recombinant slow virus carrier of three target spots, has the capability with higher efficiency for suppressing the reproduction of acquired immune deficiency syndrome viruses in comparison with the siRNA recombinant slow virus carrier of single target spot, can overcome or delay the escape of the viruses and is suitable for the acquired immune deficiency syndrome gene therapy.

Description

technical field [0001] The invention relates to the fields of molecular biology, virology and gene therapy, and more specifically relates to the construction of a multi-target siRNA recombinant lentiviral vector that can be used for AIDS gene therapy. Background technique [0002] Acquired immunodeficiency syndrome (AIDS), caused by HIV infection, is one of the major health threats facing the world. According to the assessment of my country's AIDS epidemic jointly released by the Ministry of Health, UNAIDS and the World Health Organization on November 30, 2008, as of the end of 2007, there were about 700,000 HIV-infected people and patients in China, among whom AIDS There were 85,000 patients, and the infection rate of the whole population was 0.05%. The AIDS epidemic is severe, and there is still no effective vaccine. Although the current drugs for the treatment of AIDS (such as the "cocktail" therapy HAART) can effectively prolong the survival time of patients, the drug r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867A61K48/00A61P31/18
Inventor 郭德银柳叶陈宇项念
Owner WUHAN UNIV