Tea tree cytoplasmic malate dehydrogenase gene and encoding protein thereof

A technology of malate dehydrogenase and tea tree, applied in genetic engineering, plant genetic improvement, redox enzyme, etc., can solve problems such as cloning of malate dehydrogenase gene that has not been seen yet

Inactive Publication Date: 2010-03-03
ANHUI NORMAL UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although malate dehydrogenase has important physiological and biochemical functions, so far, no complete malate dehydrogenase gene clone has been reported in tea plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tea tree cytoplasmic malate dehydrogenase gene and encoding protein thereof
  • Tea tree cytoplasmic malate dehydrogenase gene and encoding protein thereof
  • Tea tree cytoplasmic malate dehydrogenase gene and encoding protein thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] 1. Extraction of tea total RNA and acquisition of cDNA.

[0024] The total RNA of tea tree (Longjing 43) was extracted by plant total RNA purification kit (MACHEREY-NAGEL company), and the total cDNA was obtained by using the extracted tea tree total RNA by Reverse Transcription System kit (Promega company), and the total cDNA was in- Store at 20°C.

[0025] 2. Acquisition of the complete sequence of malate dehydrogenase.

[0026] Design upstream and downstream primers cyMDH-5' and cyMDH-3'

[0027] cyMDH-5' sequence: GAAAAGGTTTTCAACGCACTCTCT,

[0028] cy-MDH3' sequence: TTGGACAAAAAACTGTTACCAAGTAG

[0029] The total cDNA of tea tree was used as a template for PCR amplification. The PCR reaction program was: 95°C, 3min pre-denaturation; 95°C for 30s, 55°C for 30s, 72°C for 1min30s for 35 cycles; 72°C for 10min; 4°C storage. The PCR products were separated by 1% agarose gel electrophoresis ( figure 1 ), AxyPrep DNA Gel Recovery Kit to recover the PCR product, connect...

Embodiment 2

[0034] 1. Construction of pGEX-MDH recombinant plasmid

[0035] Design primers:

[0036] cyMDH-F1: GAGATCGC GGATCC ATGGCGAAAGAACCAGTTC;

[0037] cyMDH-F2: GTACGCCG CTCGAG AGAAAGGCAAGAGTATGCCAGA, the underlines are the restriction sites of BamHI and Xho I respectively. Using the full sequence of the Cam-cyMDH gene in Example 1 as a template, the protein coding region was amplified by PCR. The reaction conditions were: 95°C, 3min pre-denaturation; 95°C for 30s, 55°C for 30s, 72°C for 1min10s for 35 cycles; 72°C Extend for 10 min; store at 4°C. Amplified product ( figure 2 ) and the carrier pGEX-4T-1 (Famacia Company) were digested with Nde I and BamHI for 4 hours, connected, transformed into E.coli DH5α competent cells, poured on LB plates, screened positive clones, and obtained the expression plasmid pGEX- MDH. After identification by Nde I and BamHI double enzyme digestion ( image 3 ), sent to Shanghai Yingjun Biotechnology Co., Ltd. for sequencing, and the sequenc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tea tree cytoplasmic malate dehydrogenase gene and an encoding protein thereof, wherein the enzyme has an amino acid sequence shown by SEQ ID NO: 1. Compared with the prior art, the malate dehydrogenase containing a Cam-cyMDH gene can be widely used for separating D, L-malic acid and be applied to the tea tree F1 hybrid.

Description

technical field [0001] The invention relates to tea tree cytoplasmic malate dehydrogenase gene and its encoded protein. Background technique [0002] Malate dehydrogenase is widely distributed in organisms, and exists in gMDH in glyoxysomes, mMDH in mitochondria, pMDH in peroxisomes, chMDH in chloroplasts, and cyMDH in cytoplasm, although the functions of the above malate dehydrogenases are different , There are differences in the organization, the location in the cell is different, and the types of expression are different, but they all belong to the MDH isoenzyme. At present, MDH isozymes are widely used in biomolecular systematic analysis, genetic diversity and variation, individual development and species hybridization. Isozymes are polypeptide chain monomers encoded by different gene loci or alleles in the same species or genus, which are pure polymers or heteropolymers, and their primary structures, physical and chemical properties and physiological functions are diff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/04C12N15/53C12P41/00C12P7/46C12Q1/32
Inventor朱国萍陈露露王鹏翟羽佳王宝娟葛亚东曹正宇宋平苏蕊蕊
OwnerANHUI NORMAL UNIV