Tea tree cytoplasmic malate dehydrogenase gene and encoding protein thereof
A technology of malate dehydrogenase and tea tree, applied in genetic engineering, plant genetic improvement, redox enzyme, etc., can solve problems such as cloning of malate dehydrogenase gene that has not been seen yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] 1. Extraction of tea total RNA and acquisition of cDNA.
[0024] The total RNA of tea tree (Longjing 43) was extracted by plant total RNA purification kit (MACHEREY-NAGEL company), and the total cDNA was obtained by using the extracted tea tree total RNA by Reverse Transcription System kit (Promega company), and the total cDNA was in- Store at 20°C.
[0025] 2. Acquisition of the complete sequence of malate dehydrogenase.
[0026] Design upstream and downstream primers cyMDH-5' and cyMDH-3'
[0027] cyMDH-5' sequence: GAAAAGGTTTTCAACGCACTCTCT,
[0028] cy-MDH3' sequence: TTGGACAAAAAACTGTTACCAAGTAG
[0029] The total cDNA of tea tree was used as a template for PCR amplification. The PCR reaction program was: 95°C, 3min pre-denaturation; 95°C for 30s, 55°C for 30s, 72°C for 1min30s for 35 cycles; 72°C for 10min; 4°C storage. The PCR products were separated by 1% agarose gel electrophoresis ( figure 1 ), AxyPrep DNA Gel Recovery Kit to recover the PCR product, connect...
Embodiment 2
[0034] 1. Construction of pGEX-MDH recombinant plasmid
[0035] Design primers:
[0036] cyMDH-F1: GAGATCGC GGATCC ATGGCGAAAGAACCAGTTC;
[0037] cyMDH-F2: GTACGCCG CTCGAG AGAAAGGCAAGAGTATGCCAGA, the underlines are the restriction sites of BamHI and Xho I respectively. Using the full sequence of the Cam-cyMDH gene in Example 1 as a template, the protein coding region was amplified by PCR. The reaction conditions were: 95°C, 3min pre-denaturation; 95°C for 30s, 55°C for 30s, 72°C for 1min10s for 35 cycles; 72°C Extend for 10 min; store at 4°C. Amplified product ( figure 2 ) and the carrier pGEX-4T-1 (Famacia Company) were digested with Nde I and BamHI for 4 hours, connected, transformed into E.coli DH5α competent cells, poured on LB plates, screened positive clones, and obtained the expression plasmid pGEX- MDH. After identification by Nde I and BamHI double enzyme digestion ( image 3 ), sent to Shanghai Yingjun Biotechnology Co., Ltd. for sequencing, and the sequenc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 