Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting nucleic acid point mutation

A point mutation and nucleic acid technology, applied in the field of detection of nucleic acid point mutations, can solve problems such as the inability to clearly or effectively determine the detection results

Inactive Publication Date: 2010-07-07
SHANGHAI TELLGEN LIFE SCI CO LTD
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] One of the biggest difficulties encountered when reverse hybridization technology is applied to point mutation detection is that the signals detected by oligonucleotide probes for mutant and wild-type target sequences are relatively close, so the detection results cannot be clearly or effectively determined

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting nucleic acid point mutation
  • Method for detecting nucleic acid point mutation
  • Method for detecting nucleic acid point mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Detection of Leiden mutant (single mutation) of human coagulation factor V

[0087] 1. Probe design:

[0088] Amplification primers and probes for the mutation site designed for the Leiden mutation of human blood coagulation factor V

[0089] Forward primer: 5'TCCCAGTGCTTAACAAGACCA3' (SEQ ID NO: 5)

[0090] Reverse primer: 5'TGTTATCACACTGGTGCTAA3' (SEQ ID NO: 6)

[0091] The amplification product of this primer pair is 266bp.

[0092] Wild-type sequence: AGAGCAGATCCCTGGACAGGCGAGGAATACAGAGGGCAGCAGA (SEQ ID NO: 3)

[0093] Mutant sequence: AGAGCAGATCCCTGGACAGGCAAGGAATACAGAGGGCAGCAGA (SEQ ID NO: 4)

[0094] Probes designed according to traditional probe design methods:

[0095] P1: 5'CTGGACAGGCAAGGAATACA (SEQ ID NO: 14)

[0096] Probe binding region sequence designed according to the present invention:

[0097] probe name

[0098] 2. Primer and probe synthesis

[0099] Forward primer sequence: 5' biotin-TCCCAGTGCTTAACAAGACCA 3' (SEQ ID NO: 5)

[0100] Re...

Embodiment 2

[0161] Effect of Tethers on Point Mutation Outcomes

[0162] Select the binding region of probe P3 (SEQ ID NO: 8), repeat Example 1, the difference is: (a) replace the connection of 10-mer polyT with the polyT linker of 12-mer, 14-mer, and 16-mer arm.

[0163] The results showed that, similar to the results in Example 1, the ratio of the detection signal for the single mutation sample to the signal for the normal control was 4.0 (much greater than 2.5), so the detection result could be clearly determined. This suggests that the length of the tether does not interfere with the detection of point mutations.

Embodiment 3

[0165] detection test

[0166] Probe P3 (the binding region is SEQ ID NO: 8; the connecting arm is 10-mer polyT) is selected to detect 10 nucleic acid samples. These nucleic acid samples are artificially prepared, including the following four types of samples:

[0167] 1. A sample containing the sequence of the wild type of SEQ ID NO:3;

[0168] 2. A sample containing a sequence of a mutant of SEQ ID NO: 4;

[0169] 3. A sample containing both the wild-type sequence of SEQ ID NO: 3 and the mutant sequence of SEQ ID NO: 4;

[0170] 4. A sample containing neither the sequence of the wild type of SEQ ID NO: 3 nor the sequence of the mutant of SEQ ID NO: 4.

[0171] The test was carried out without telling the sample type (the method is the same as in Example 1), and the test results were compared with the types of each sample.

[0172] The results showed that the detection results were completely consistent with the types of the samples.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting nucleic acid point mutation. Specially, the method of the invention comprises: a nucleic acid sample to be detected is hybridized with the probe of the invention so as to detect whether a nucleic acid to be detected-probe hybridization compound is formed or not; an artificial mismatching locus is additionally introduced into the probe sequence of the invention so as to generate two mismatching locus between a probe binding area and a point mutation containing sequence to be detected. When being used, the probe of the invention has obvious difference on wild and mutant detection signals by the probe in the reverse hybrid detecting nucleic acid point mutation so as to definitely judge the detection result. Experiments show that the invention can effectively improve the detection signal-to-noise ratio so as to improve detection sensitivity.

Description

technical field [0001] The invention relates to the technical field of nucleic acid diagnosis, in particular to a method for detecting nucleic acid point mutations. More specifically, it relates to a method of using oligonucleotide probes to perform reverse hybridization on PCR products to detect nucleic acid point mutations. The method of the invention can effectively improve the detection signal-to-noise ratio and thereby improve detection sensitivity. Background technique [0002] Reverse hybridization is an important technical method for nucleic acid detection, and is widely used in chip-type technologies that can perform high-throughput detection. [0003] The basic principle of reverse hybridization is to first covalently cross-link oligonucleotide probes on the surface of a certain solid phase carrier, such as membrane strips, microspheres (such as different fluorescent microspheres), etc.; Nucleotide mixing, in a certain hybridization system, the oligonucleotide pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 姚见儿白艳军谈畅李久彤
Owner SHANGHAI TELLGEN LIFE SCI CO LTD