Method for detecting nucleic acid point mutation
A point mutation and nucleic acid technology, applied in the field of detection of nucleic acid point mutations, can solve problems such as the inability to clearly or effectively determine the detection results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Detection of Leiden mutant (single mutation) of human coagulation factor V
[0087] 1. Probe design:
[0088] Amplification primers and probes for the mutation site designed for the Leiden mutation of human blood coagulation factor V
[0089] Forward primer: 5'TCCCAGTGCTTAACAAGACCA3' (SEQ ID NO: 5)
[0090] Reverse primer: 5'TGTTATCACACTGGTGCTAA3' (SEQ ID NO: 6)
[0091] The amplification product of this primer pair is 266bp.
[0092] Wild-type sequence: AGAGCAGATCCCTGGACAGGCGAGGAATACAGAGGGCAGCAGA (SEQ ID NO: 3)
[0093] Mutant sequence: AGAGCAGATCCCTGGACAGGCAAGGAATACAGAGGGCAGCAGA (SEQ ID NO: 4)
[0094] Probes designed according to traditional probe design methods:
[0095] P1: 5'CTGGACAGGCAAGGAATACA (SEQ ID NO: 14)
[0096] Probe binding region sequence designed according to the present invention:
[0097] probe name
[0098] 2. Primer and probe synthesis
[0099] Forward primer sequence: 5' biotin-TCCCAGTGCTTAACAAGACCA 3' (SEQ ID NO: 5)
[0100] Re...
Embodiment 2
[0161] Effect of Tethers on Point Mutation Outcomes
[0162] Select the binding region of probe P3 (SEQ ID NO: 8), repeat Example 1, the difference is: (a) replace the connection of 10-mer polyT with the polyT linker of 12-mer, 14-mer, and 16-mer arm.
[0163] The results showed that, similar to the results in Example 1, the ratio of the detection signal for the single mutation sample to the signal for the normal control was 4.0 (much greater than 2.5), so the detection result could be clearly determined. This suggests that the length of the tether does not interfere with the detection of point mutations.
Embodiment 3
[0165] detection test
[0166] Probe P3 (the binding region is SEQ ID NO: 8; the connecting arm is 10-mer polyT) is selected to detect 10 nucleic acid samples. These nucleic acid samples are artificially prepared, including the following four types of samples:
[0167] 1. A sample containing the sequence of the wild type of SEQ ID NO:3;
[0168] 2. A sample containing a sequence of a mutant of SEQ ID NO: 4;
[0169] 3. A sample containing both the wild-type sequence of SEQ ID NO: 3 and the mutant sequence of SEQ ID NO: 4;
[0170] 4. A sample containing neither the sequence of the wild type of SEQ ID NO: 3 nor the sequence of the mutant of SEQ ID NO: 4.
[0171] The test was carried out without telling the sample type (the method is the same as in Example 1), and the test results were compared with the types of each sample.
[0172] The results showed that the detection results were completely consistent with the types of the samples.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 