PCR specific amplified primer for fast detection of vibrio parahaemolyticus based on SCAR molecular markers and detection kit
A technology of Vibrio hemolyticus and molecular marker, applied in DNA/RNA fragmentation, recombinant DNA technology, determination/inspection of microorganisms, etc., can solve the problems of animal death, low accuracy, hidden dangers to human health, etc., and achieve good specificity. , high practical value, high sensitivity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0017] The embodiment of the present invention utilizes more than 200 RAPD primers to detect vibrio parahaemolyticus (Vibrioparahaemolyticus) (ATCC 17802), vibrio vulnificus (Vibrio vulnificus) (ATCC 27562), vibrio alginolyticus (Vibrio alginolyticus) (ATCC 17749), river Vibrio fluvialis (ATCC 33810), Vibrio mimicus (ATCC 33653), Vibrio harveyi (ATCC 33842), Vibrio campbellii (ATCC 33864) and Vibrio shark Species-specific SCAR marker developed on Vibrio (Vibriocarchariae) (ATCC 35084) and transformed into Vibrio parahaemolyticus, its nucleotide sequence is:
[0018] ACTACCGAACACGGGCTGTATACGTTTAGCGAAATGGATAGAAATGAAGGTGCAGAGCTCGCGTTTTTTCGCGGTAGTGAATCCGTCTCTTTGCCGATTAATGGCGATTATCCGTGTCATTTGGATATCAAAGAACCGTTGTTGGCGGTTGCTAATTATGGCTCTGGAAATGTTAGCGTATTTCAATTGGATCGCGATGGTAAACCGCTTGGTTTATTGGCGGATTTATACGTTGATGGATGCGGGCCGAATTTAGAGCGCCAAACTTCTCCTCACGCTCATCAAGTCACGTTTTTAAAGCACAGTCATCAATTGGTTGTCGTAGACTTAGGCAGCGATAGCGTCCTTATTTATGATTACGATGCCCAGCC。
[0019] In the embodiment of the present inv...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap