PCR specific amplified primer for fast detection of vibrio parahaemolyticus based on SCAR molecular markers and detection kit

A technology of Vibrio hemolyticus and molecular marker, applied in DNA/RNA fragmentation, recombinant DNA technology, determination/inspection of microorganisms, etc., can solve the problems of animal death, low accuracy, hidden dangers to human health, etc., and achieve good specificity. , high practical value, high sensitivity effect

Active Publication Date: 2010-08-18
DALIAN FISHERIES UNIVERSITY
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, Vibrio parahaemolyticus (Vibrioparahaemolyticus) can cause large-scale deaths of farmed animals such as fish, shrimp, shellfish, and sea cucumbers, and it also brings hidden dangers to human health who accidentally eat food infected with Vibrio parahaemolyticus
At present, the detection methods for Vibrio include physiological and biochemical identification technology, enzyme-linked immunosorbent assay, 16S rRNA gene identification, etc., respectively have the following shortcomings: physiological and biochemical identification technology is time-consuming and laborious, and the detection accuracy is low; enzyme-linked immunosorbent assay The sensitivity is not high; 16S rRNA gene identification can only identify the pathogenic Vibrio to the genus, but not to the species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR specific amplified primer for fast detection of vibrio parahaemolyticus based on SCAR molecular markers and detection kit
  • PCR specific amplified primer for fast detection of vibrio parahaemolyticus based on SCAR molecular markers and detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0017] The embodiment of the present invention utilizes more than 200 RAPD primers to detect vibrio parahaemolyticus (Vibrioparahaemolyticus) (ATCC 17802), vibrio vulnificus (Vibrio vulnificus) (ATCC 27562), vibrio alginolyticus (Vibrio alginolyticus) (ATCC 17749), river Vibrio fluvialis (ATCC 33810), Vibrio mimicus (ATCC 33653), Vibrio harveyi (ATCC 33842), Vibrio campbellii (ATCC 33864) and Vibrio shark Species-specific SCAR marker developed on Vibrio (Vibriocarchariae) (ATCC 35084) and transformed into Vibrio parahaemolyticus, its nucleotide sequence is:

[0018] ACTACCGAACACGGGCTGTATACGTTTAGCGAAATGGATAGAAATGAAGGTGCAGAGCTCGCGTTTTTTCGCGGTAGTGAATCCGTCTCTTTGCCGATTAATGGCGATTATCCGTGTCATTTGGATATCAAAGAACCGTTGTTGGCGGTTGCTAATTATGGCTCTGGAAATGTTAGCGTATTTCAATTGGATCGCGATGGTAAACCGCTTGGTTTATTGGCGGATTTATACGTTGATGGATGCGGGCCGAATTTAGAGCGCCAAACTTCTCCTCACGCTCATCAAGTCACGTTTTTAAAGCACAGTCATCAATTGGTTGTCGTAGACTTAGGCAGCGATAGCGTCCTTATTTATGATTACGATGCCCAGCC。

[0019] In the embodiment of the present inv...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses a PCR specific amplified primer for the fast detection of vibrio parahaemolyticus based on SCAR molecular markers and a detection kit. The nucleotide sequences of a forward primer and a reverse primer are as follows: the nucleotide sequence of the forward primer VpaF is 5'-ACTACCGAACACGGGCTGTAT-3'; and the nucleotide sequence of the reverse primer VpaR is 5'-GGCTGGGCATCGTAATCAT-3'.The kit comprises a mixed liquid of the PCR specific amplified forward primer VpaF and reverse primer VpaR dissolved in sterile double distilled water, wherein the concentration is 0.5-2 mu M. Cultured vibrio colony can be directly used to be subject to the PCR reaction for detection without extracting DNAs of the vibrio genome, thereby achieving the effects of time saving, labor saving, convenience, high speed, accuracy, good specificity and high sensitivity. The kit can be used for tracing the detection of the vibrio parahaemolyticus in the marine animal culturing process and monitoring the briny environment, thereby achieving high use value.

Description

Technical field: [0001] The invention relates to a PCR-specific amplification primer and a detection kit for detecting pathogenic bacteria in seawater cultured animals, in particular to a SCAR (Sequence characterized amplified region, characteristic sequence detection kit) with high detection accuracy and sensitivity, short time and low cost. Amplification region) PCR-specific amplification primers and detection kits for rapid detection of Vibrio parahaemolyticus by molecular markers. Background technique: [0002] Vibrio is the main conditional pathogenic bacteria of marine animals. Pathogenic Vibrio can cause explosive death of farmed animals. Together with viruses, other bacteria or parasites, it will cause huge damage to marine animals. It is recognized as It is one of the most serious diseases in mariculture. For example, Vibrio parahaemolyticus can cause large-scale deaths of farmed animals such as fish, shrimp, shellfish, and sea cucumbers, and it also brings hidden ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCY02A50/30
Inventor 仇雪梅田春雨王秀利
Owner DALIAN FISHERIES UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products