Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit for vibrio cholerae O1 group and detection method thereof

A detection kit and Vibrio cholerae technology, which is applied in biochemical equipment and methods, microbial measurement/inspection, and resistance to vector-borne diseases, etc. It can solve the problems of low missed detection rate, long time-consuming, high missed detection rate, etc. Achieve high accuracy, high yield, and high verification rate

Active Publication Date: 2010-09-08
GUANGZHOU HUAFENG BIOTECH +1
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] One of the technical problems to be solved by the present invention is to overcome the shortcomings of long time consumption and high missed detection rate in the prior art to provide a Vibrio cholerae O1 group detection kit with more comprehensive detection effect, high specificity and low missed detection rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for vibrio cholerae O1 group and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The preparation of embodiment 1 kit

[0050] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0051] Outer primer F3: ACATCACCACAGCCTCTT (SEQ ID NO1)

[0052] Outer primer B3: TCGAACCTAGAAGTGTGTG (SEQ ID NO 2)

[0053] Internal primer FIP: AGTCTTTGTGAGTGTGGTAAAGCTTTTTCTGCTTTTTTTGCTCGTCC (SEQ ID NO 3)

[0054] Inner primer BIP: AGGTCATCTGTAAGTACAACATTCCTTTTGTAAAGTAGGCTTACTTGAGTT (SEQ ID NO 4).

[0055] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;

[0056] (3) Prepare the reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / LTris-Cl, 12.5mmol / LKCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / LMgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, placed in the container;

[0057] (4) Prepare the sample pretreatment solution: the sample pretreatment solution contains 20mmol / L...

Embodiment 2

[0076] The preparation of embodiment 2 kit

[0077] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0078] Outer primer F3: ACCCAATACTGAGGCGATA (SEQ ID NO5)

[0079] Outer primer B3: CACTTGCGAGTGAAGAGC (SEQ ID NO 6)

[0080] Inner primer FIP:

[0081] TCAGGTTATTCATATTGGTGGTTGGTTTTTAAAGGTAATTTTTATCCACCTTCTC (SEQ ID NO 7)

[0082] Internal primer BIP: GCAATTGAAACGAGATCCCCTTGTTTTGCTCATAATTTTTGGATTCACGT (SEQ ID NO 8)

[0083] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;

[0084] (3) Preparation of reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / LTris-Cl, 10mmol / LKCl, 10mmol / L (NH4)2SO4, 8mmol / LMgSO4, 0.1vol%TritonX-100, 0.8mol / L Betaine, 0.25 μmol / L each of inner primer FIP / BIP and 1.2 μmol / L each of outer primer F3 / B3 are placed in the container;

[0085] (4) Prepare the sample pretreatment solution: the sample pretreatment solution contains 10mmol / L...

Embodiment 3

[0100] Example 3 Application of Vibrio cholerae O1 Group Detection Kit

[0101] 1 Materials and methods

[0102] 1.1 Materials

[0103] 1.1.1 Strains

[0104] The present invention adopts 17 bacterial strains, mainly from the Chinese Center for Disease Control and Prevention, the Shanghai Center for Disease Control and Prevention, and the Pudong New Area Center for Disease Control and Prevention. See Table 1 for details.

[0105]

[0106]1.2 Identification of isolated strains

[0107] 1.2.1 Inoculate the specimen on TCBS agar and double-washed plate. Yellow colonies appear on TCBS, and colonies with gray-black center appear on the double-washed plate are suspicious colonies. Under the microscope, the bacterium is a slightly curved bacillus, short and comma-shaped, with a single flagella at one end of the bacterium, and the movement is lively and shuttle-like, and Gram staining is negative. Biochemical reaction: oxidase + sucrose + indigo substrate - hydrogen sulfide ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection kit for a vibrio cholerae O1 group, which comprises BstDNA polymerase, reaction liquid, sample pretreatment liquid, coloration liquid, stabilizing solution and positive control, and also comprises two pairs of primers which take vibrio cholerae RfbN genes as target genes and two pairs of primers which are designed based on the loop-mediated isothermal amplification technology, namely inner primers FIP / BIP and outer primers F3 / B3. The detection kit for the vibrio cholerae O1 group has the advantages of comprehensive detection effect, high specificity and low omission factors, and is suitable for the quick detection of the vibrio cholerae O1 group.

Description

technical field [0001] The invention relates to the technical field of in vitro diagnostic reagents, in particular to a detection kit for Vibrio cholerae O1 group and a detection method thereof. [0002] Background technique [0003] Cholera is a severe infectious disease with diarrhea as the main symptom. So far, seven world pandemics have occurred. The seventh world pandemic of cholera, caused by Vibrio cholerae Eltor, began in 1961 and affected 140 countries and regions. More than 4 million cases were reported. According to the WHO expert meeting, there are about 5.5 million cases worldwide each year, among which Asia, Africa and Latin America are more serious, causing 100,000 deaths in Asia and 20,000 deaths in Africa. To this day, cholera remains one of the most dangerous infectious diseases. Therefore, early rapid and correct diagnosis is of great significance to the treatment and prevention of the spread of this disease. [0004] At present, Vibrio cholerae has...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
CPCY02A50/30
Inventor 方筠田桢干张晓航张琳韩晓辉阎俊张继伦何宇平曹以诚杜正平陈洵柯佳佳冯雪梅
Owner GUANGZHOU HUAFENG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com