Check patentability & draft patents in minutes with Patsnap Eureka AI!

Double-signal transgenic cell sensor for screening chemopreventive agent and establishment method thereof

A technology of transgenic cells and chemoprevention, which can be applied to cells modified by the introduction of foreign genetic material, introduction of foreign genetic material using vectors, recombinant DNA technology, etc. It can solve the problems of pollution, time-consuming, and insensitivity.

Inactive Publication Date: 2011-01-19
YANGZHOU UNIV
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In order to solve the problems of long time consumption, insensitivity and pollution in existing screening methods, the present invention provides a dual-signal transgenic cell sensor for rapid screening of chemopreventive agents, which is used for tumor prevention drug screening and effectively solves the problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-signal transgenic cell sensor for screening chemopreventive agent and establishment method thereof
  • Double-signal transgenic cell sensor for screening chemopreventive agent and establishment method thereof
  • Double-signal transgenic cell sensor for screening chemopreventive agent and establishment method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of the dual-signal transgenic cell sensor of the present invention

[0024] (1) Construction of red and green dual-color fluorescent protein reporter vector

[0025] 1) Construction of pMD-DsRed vector:

[0026] The red fluorescent protein and its promoter sequence were amplified from the plasmid pDsRed2-N1 (Clontech Company) by PCR, and the upstream primer was 5'-CGCC CTTAAG TAGTTATTAATAGTAATCAATT -3' (SEQ ID NO: 1), the downstream primer is 5'-GAG CACGTAGTG CTACAGGAACAGGTGGTGGCGG-3' (SEQ ID NO: 2). Two restriction sites (shown in boldface) of BspT I and Ade I were respectively designed at the 5' end of the primer, and 3~4 protective bases were added. The PCR amplification product was purified and recovered by a purification kit, and then connected to the pMD18-T vector (TaKaRa Company). The positive clone vector was identified by conventional enzyme digestion and sequenced, and named pMD-DsRed;

[0027] 2) Construction of the p4ARE-TK-GFP...

Embodiment 2

[0032] HepG2-4ARE-TK-GFP / DsRed was inoculated into a black 96-well culture plate, the number of cells per well was 5×10 4 After culturing for 24 h, different concentrations of the test substances pyrrolidine dithiocarbamate (PDTC) and tert-butylhydroquinone (tBHQ) prepared in dimethyl sulfoxide (DMSO) were added. The final concentration of the substance was designed as: 0 (control), 12.5, 25, 50, 100 and 200 μM, each concentration group had 3 repetitions, 37°C, 5% CO 2 After 24-48 h in the incubator, 200?L PBS was added to each well after washing with PBS, and the fluorescence intensity of GFP and DsRed of the cells was detected with a multifunctional fluorescent microplate reader, and the excitation wavelength / emission wavelength were 485 nm / 530 nm (GFP) and 558 nm / 583 nm (DsRed), find their relative luminosity.

[0033] The results are shown in Table 1, Figure 6 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a double-signal transgenic cell sensor for screening a chemopreventive agent and an establishment method thereof. The double-signal transgenic cell sensor is provide with an antioxidant response element (ARE), a TK promoter, enhanced green fluorescent protein (EGFP) and red fluorescent protein (DsRed), wherein expression of the EGFP is regulated and controlled by the ARE. The establishment method comprises the following steps: firstly establishing a eukaryotic reporter vector which is started by the TK promoter and regulated and controlled by four ARE repetitive sequences at upstream; inserting the DsRed and promoter fragments thereof into the vector to establish a double-signal reporter vector; and transfecting the reporter carrier with an HepG2 cell to obtain a transgenic cell, namely, the double-signal transgenic cell sensor of the invention. The established double-signal transgenic cell sensor of the invention which takes the EGFP as a reporter gene and the DsRed as internal reference requires no any substrate and auxiliary reagent, is safe and has convenient operation, short time, low expense and no environmental pollution.

Description

technical field [0001] The invention belongs to the field of tumor prevention, and in particular relates to a dual-signal transgenic cell sensor for rapid screening of chemopreventive agents and a construction method thereof. Background technique [0002] Chemopreventive agents refer to a class of natural or synthetic compounds that can prevent, delay and reverse the development of cancer. There are few methods dedicated to the in vitro detection of chemopreventive agents. The existing method is to recombine the antioxidant response element (ARE), TK promoter and green fluorescent protein (GFP) gene (reporter gene) into HepG2 cells to make the expression of GFP The amount is under the control of ARE. Use ethidium bromide (EB) staining to correct the influence of cell number on the detection results, directly detect the fluorescence intensity of GFP and EB, and screen or detect chemopreventive agents by relative fluorescence intensity. This method avoids the need to destroy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/63C12N15/65
Inventor 徐海荣卜平李湘鸣
Owner YANGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More