Method for expanding antigen spectrum of foot-and-mouth disease vaccine strain by reverse genetic operation and preparation method of vaccine
A foot-and-mouth disease virus and vaccine technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and microorganism-based methods, can solve problems such as impossible realization, time-consuming and labor-intensive vaccine strains, and unsatisfactory screening requirements. Improve the protection rate and the effect of broad antigen spectrum
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Embodiment 1, preparation and functional verification of mutant strains
[0059] 1. Construction of the full-length cDNA recombinant plasmid corresponding to the foot-and-mouth disease virus genome RNA
[0060] Design and synthesize the following oligonucleotide primers (synthesized by Shanghai Sunny Co., Ltd.):
[0061] Z1: ag Actagt ttgaaagggggcgctagggt
[0062] Z1-2: tggttggggggggggggggggtgaa
[0063] Z2: ttcaccccccccccccccccaaccaacca
[0064] Z2-2: agcgtggagtcgagcacagtac
[0065] Z3: ggtctaagcaggtttccacaactg
[0066] Z3-2: aactgcagtgcttcgtgctgccctttctcaatg
[0067] Z4: gctaagcttggaactccacgaaaaggtgtcga
[0068] Z4-2: tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt: Nucleotides in italics are additional restriction sites and protective bases, and the following are nucleotides in the sequence].
[0069] T1: gaaaacgcctgaggccgccgcacactgcatt
[0070] T1-2: aatgcagtgtgcggcggcctcaggcgttttc
[0071] T2: gtgaagaagatatctg...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com