Unlock instant, AI-driven research and patent intelligence for your innovation.

Humanized breast cancer antigen and antibody thereof

A breast cancer and antigen technology, applied in the direction of antibodies, receptors/cell surface antigens/cell surface determinants, anti-tumor drugs, etc., can solve the problem of decreased self-resistance of patients, ineffective early detection of breast cancer, and harm to normal tissues And immune cells and other problems, to achieve the effect of high expression positive rate and broad prospects

Inactive Publication Date: 2011-02-02
NANKAI UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, no matter which of the above methods is used for treatment, it is not obvious for the early detection of frequent breast cancer
Moreover, these methods do not have a targeted killing effect on breast cancer cells, that is, in the process of killing cancer cells, a large number of surrounding normal tissues and immune cells will be damaged, resulting in the decline of the patient's own resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Humanized breast cancer antigen and antibody thereof
  • Humanized breast cancer antigen and antibody thereof
  • Humanized breast cancer antigen and antibody thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Preparation of new human breast cancer recombinant protein antigen

[0040] Firstly, the c-terminal primer of the new human breast cancer antigen Hv1 was designed, the sequence is as follows:

[0041] C-Hv1BamH I-F: 5'CGCGGATCC AAGACACGTTCAGAACGGC (SEQ NO.2)

[0042] EcoR I-R: 5'CGGAATTCCTAGTTCACTTCACCAAGAAG (SEQ NO.3)

[0043] Through PCR amplification, the PCR product and the vector pGEX6p-1 were double digested and recovered, ligated to obtain a recombinant plasmid, and the sequencing results are shown in figure 1 . This clone is the clone of the recombinant expression plasmid containing the human breast cancer antigen DNA sequence of the present invention, and it is named pGEX6p-1-c-Hv1. pGEX6p-1-c-Hv1 was transformed into competent E.coli BL21(DE3) Escherichia coli, and 0.5mM IPTG inducer was used for protein expression. The recombinant protein antigen was purified by ion exchange column, and the amino acid sequence was shown in the sequence table SE...

Embodiment 2

[0044] Example 2: Preparation of anti-human breast cancer antigen Hv1 antibody

[0045] (1) Mouse polyclonal antibody

[0046] Using 50ug / recombinant protein antigen of human breast cancer antigen Hv1 mixed with complete Freund's adjuvant for multi-point subcutaneous immunization of Balb / c mice, 10 days later using 50ug / recombinant protein antigen of human breast cancer antigen Hv1 mixed without Balb / c mice were immunized subcutaneously with complete Freund's adjuvant for the second time. After the second immunization, the third immunization was carried out at intervals of one week. 10 days after the third immunization, blood was collected to measure the titer, when the titer was >1:10 6 , the animals were sacrificed to collect blood, the serum was collected by coagulation method, and centrifuged at low speed to remove the precipitate. Diluted with normal saline 1:2, purified on a Protein A affinity chromatography column, eluted with 0.1M glycine buffer at pH 2.8, neutraliz...

Embodiment 3

[0051] Preparation of anti-human breast cancer antigen Hv1 corresponding antibody derivatives

[0052] (1) Nuclide-antibody conjugates

[0053] (1) 188 Re-labeled anti-human breast cancer antigen Hv1 corresponding mouse monoclonal antibody

[0054] SnCl 2 The antibody was labeled by the direct reduction method, and the labeling efficiency and radiochemical degree of the antibody were measured immediately by rapid thin-layer chromatography (ITLC). After labeling, ITLC experiments show that: 188 The Re-antibody labeling rate is 90%, and the radiochemical purity is greater than 95%. 188 Re-antibody specific activity is 356MBq / mg. measured by ELISA 188 Re-antibody immunoactivity was 65%. The in vitro stability experiment of the labeled antibody showed that when the antibody was incubated at 37°C for 24 hours, no matter in normal saline or human serum albumin, the radioactive shedding was less than 5%, indicating that it was stable in vitro.

[0055] (2) 131 I-labeled anti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a humanized breast cancer antigen and an antibody thereof. The amino acid residue sequence of the antigen is shown in a sequence list 1. The antigen is a natural antigen or a recombinant protein antigen, which is mainly expressed in cancer cells of the human breast cancer, but is not expressed in human normal cells; and the antigen can be used as a target point of human breast cancer active immunotherapy or prevention and as a target point of various targeted immunological therapies. The invention also provides an antibody resistant to the humanized breast cancer antigen. The antibody is a polyclonal antibody, a mouse monoclonal antibody or antibody segment, and derivates of the antibodies, wherein the derivates comprise the antibody crosslinked with nuclide, the antibody crosslinked with chemical medicaments, the antibody crosslinked with liposome, the antibody fused with a medicament preemzyme, the antibody fused with other effector molecules and the like. The invention also provides application of the antibody and derivates resistant to the humanized breast cancer antigen Hv1 in the preparation of medicaments for diagnosing, treating and preventing human breast cancer.

Description

【Technical field】 [0001] The invention relates to a novel human breast cancer antigen voltage-gated proton channel Hv1 and its antibody. Hv1 is not expressed in normal breast tissue, but is abundantly expressed in breast cancer tissue. The invention provides polyclonal / monoclonal antibodies, antibody fragments and derivatives corresponding to the human breast cancer antigen Hv1, which can be widely used in the diagnosis, prevention and treatment of breast cancer. 【Background technique】 [0002] Breast cancer is one of the most common malignant tumors that seriously affects women's physical and mental health and even threatens their lives. According to statistics, among women, the incidence of breast cancer is second only to uterine cancer, accounting for 7-10% of various malignant tumors in the whole body. Between the ages of 40 and 60, the incidence rate of women before and after menopause is higher. Only about 1-2% of breast cancer patients are men. [0003] Breast can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61P35/00G01N33/574C12N15/63C07K16/06C12R1/19C12N1/21C07K16/30G01N33/577C12N15/12C07K14/705A61K39/395
Inventor 李树杰王一凡潘君成赵青王汉中
Owner NANKAI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More