Unlock instant, AI-driven research and patent intelligence for your innovation.

Retinol binding protein (RBP) monoclonal antibody and hybridoma cells, preparation method and application thereof

A technology of hybridoma cell lines and hybridoma cell lines, applied in the direction of fusion cells, biochemical equipment and methods, anti-animal/human immunoglobulin, etc., to achieve high sensitivity

Active Publication Date: 2011-02-09
SHANGHAI IMMUNE BIOTECH +1
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

More and more experimental studies have found that DNA vaccines have good effects in immune defense, but DNA vaccines still face many challenges, such as the immunological mechanism of DNA vaccination, the theoretical safety of nucleic acid vaccines, etc. , further experiments are needed to clarify

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Retinol binding protein (RBP) monoclonal antibody and hybridoma cells, preparation method and application thereof
  • Retinol binding protein (RBP) monoclonal antibody and hybridoma cells, preparation method and application thereof
  • Retinol binding protein (RBP) monoclonal antibody and hybridoma cells, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0088] The present invention provides a kind of preparation method of new hybridoma cell, comprises the steps:

[0089] (a) immunizing animals with a recombinant expression vector containing a polynucleotide of the target protein;

[0090] (b) fusing spleen cells or lymph node cells of the animal with myeloma cells;

[0091] (c) Screening to obtain hybridoma cell lines producing monoclonal antibodies to the target protein.

[0092] The target protein can be any protein, including but not limited to human RBP4 protein.

[0093] The preparation method of RBP4 hybridoma cell line of the present invention comprises steps:

[0094] (a) immunizing animals with a recombinant expression vector containing a polynucleotide of RBP4 protein;

[0095] (b) fusing spleen cells or lymph node cells of the animal with myeloma cells;

[0096] (c) Screening to obtain RBP4 hybridoma cell lines.

[0097] The preparation method of above-mentioned RBP4 hybridoma cell, comprises the steps:

[00...

Embodiment 1D

[0110] The structure of embodiment 1 DNA vaccine

[0111] Using the previously constructed recombinant plasmid of pET28a-RBP4 (see patent 200610117198.7 for details) as a template, the primer forward primer RBP-Sp (SEQ ID NO: 1) with Kpn I and Xho I restriction sites added at both ends: CGGGGTACCATGATGAAGTGGGTGTGGGCGCT And reverse primer RBP-AS (SEQ ID NO: 2): CCGCTCGAGTCGCTACAAAAGGTTTCTTTCTGATC, PCR amplification obtains the coding sequence of retinol binding protein 4, and the coding sequence of obtained retinol binding protein 4 is directionally connected to the pBudCE4.1 vector (Invitrogen Company) Kpn I and Xho I site, obtain pBudCE4.1-RBP4 recombinant plasmid, this recombinant plasmid is DNA vaccine. The cloned gene was verified by sequencing (Shanghai Handsome Biotechnology Co., Ltd.) to contain no meaningful mutations.

Embodiment 2

[0112] Example 2 pBudCE4.1-RBP4 recombinant plasmid transfected 293T cells, RBP4-His fusion protein detection

[0113] The constructed pBudCE4.1-RBP4 recombinant plasmid was transiently transfected into 293T cells by lipofectamine 2000 (Invitrogen), and the expression of RBP4-His fusion protein was detected by Western Blotting (results in figure 1 ).

[0114] Primary antibody: anti-his tag (1:2000) (Tiangen)

[0115] Secondary antibody: goat-anti-mouse HRP (1:1000) (Zhongke Yingmu)

[0116] figure 1 It shows that lane 1 has the expression of RBP4-His fusion protein.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a retinol binding protein (RBP) monoclonal antibody, a hybridoma cell line generating the monoclonal antibody, a method for preparing the monoclonal antibody and application of the monoclonal antibody. The monoclonal antibody of the invention can be highly specifically combined with RBP4 antigen and has high affinity.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a retinol-binding protein monoclonal antibody, its hybridoma cells, its preparation method and application. Background technique [0002] Retinol-binding protein (RBP) is a specific transporter of vitamin A (VitA) in blood. RBP is a low-molecular-weight protein that can freely filter the glomeruli and be almost completely reabsorbed in the proximal renal tubules. Its changes in hematuria are closely related to kidney diseases. RBP is mainly synthesized by the liver, supplemented by serum, cerebrospinal fluid, urine and other body fluids. Seven different RBP subtypes have been found, mainly distributed in the blood circulatory system (RBP4, referred to as RBP), cells (RBP1, RBP2, RBP5, RBP6, RBP7, referred to as RBPs) and between retinal photoreceptors (RBP3, referred to as IRBP) . [0003] RBP4 (NM_006744) is a single peptide chain protein, containing 184 amino acid residues and 3...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P21/08G01N33/577C12N5/16C07K16/18C12N5/20A61K39/395
Inventor 孙兵凌志洋朱静嬿吴洪强唐琳娜李炳南史群芳
Owner SHANGHAI IMMUNE BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com