Unlock instant, AI-driven research and patent intelligence for your innovation.

Serum maker of HBV (hepatitis B virus) infestor and application thereof

A serum marker, technology for infected people, used in biotechnology and medicine

Inactive Publication Date: 2011-04-20
FUDAN UNIV
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no CypA as a serum marker for hepatitis B virus infection at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serum maker of HBV (hepatitis B virus) infestor and application thereof
  • Serum maker of HBV (hepatitis B virus) infestor and application thereof
  • Serum maker of HBV (hepatitis B virus) infestor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 Animal Experimental Research

[0039] (1) Construction of HBsAg eukaryotic expression plasmid

[0040] According to the HBV whole genome sequence C8 (GenBank accession number AF461363) published in GenBank (http: / / www.ncbi.nlm.nih.gov / ) as a template, PCR primers were designed using known techniques (upstream primers were cta ggatcc atggagagcacaacatcag, downstream primer is gcc gaattc tcaaatgtatacccaaagac), using PCR technology to amplify the complete HBsAg coding sequence. Insert the amplified HBsAg gene fragment between the BamHI and EcoRI restriction sites in the multi-cloning site region of Invitrogen's pcDNA3.1 plasmid vector. The HBsAg gene expression is controlled by the CMV promoter and can be expressed in eukaryotic cells .

[0041] (2) Using known high-pressure tail vein injection technique to express HBsAg in mouse liver

[0042] Dilute 10 μg of HBsAg eukaryotic expression plasmid in Ringer’s isotonic buffer (154mM NaCl, 5.63mM KCl, 2.25mM ...

Embodiment 2

[0054] Example 2 Research on Serum CypA Content of Patients with Chronic Hepatitis B

[0055] 1. Collect the serum of chronic hepatitis B patients and healthy normal people

[0056] The criteria for the diagnosis of chronic hepatitis B are that the serum HBsAg has been positive for at least 6 months, the serum transaminase level has increased by at least 2 times, and it is accompanied by other corresponding symptoms. The corresponding control group is the general anti-group without hepatitis B virus infection and normal serum transaminase level. All samples were ruled out the possibility of hepatitis C (hepatitis Cvirus, HCV), hepatitis D virus (HDV), and human immunodeficiency virus (humanimmunodeficiency virus 1, HIV-1) co-infection. Take 1ul of serum and separate it by SDS-PAGE gel electrophoresis, then transfer the protein to the nitrocellulose membrane with 200mA constant flow for 1 hour, and then block with 5% skim milk powder solution at room temperature for 2 hours, t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of biotechnology and medicine, relates to a new serum marker of an HBV (hepatitis B virus) infestor, in particular to serum marker cyclophilin A capable of reflecting the inflammatory response of visceral organs of the HBV infestor as well as a serum content determining method and an application thereof in diagnosing and curing chronic hepatitis B. In the invention, the serum CypA protein content change can be detected by a Western Biot or an ELISA method, and tests prove that the CypA protein content in serum of an HBV patient is obviously increased, which is related to the liver inflammatory response, thus being a noninvasive, simple, convenient and rapid serum marker in the HBV disease course development, and being capable of used for preparing an HBV diagnosis kit and an antiviral drug. The established detection technology can be used for disease course and prognostic judgment and treatment evaluation for the HBV infestor and development of anti-hepatitis B drugs.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine. It involves a new serum marker of hepatitis B virus infection. Specifically, the present invention relates to a serum marker cyclophilin A (CypA), which can reflect the organ inflammatory response of hepatitis B patients, a method for measuring its serum content, and its use in the diagnosis and treatment of chronic hepatitis B. Background technique [0002] Hepatitis B virus (HBV) infection is a common infectious disease. According to the statistics of the World Health Organization, about 350 million people in the world have developed into chronic carriers due to the inability to clear the virus. With the development of the disease, among these patients with persistent infection, more than 1 million people die every year from chronic active hepatitis, liver cirrhosis and primary liver cancer. All kinds of liver diseases caused by hepatitis B virus infection. China is one of the mos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/68G01N33/576G01N21/76
Inventor 田晓晨闻玉梅
Owner FUDAN UNIV