Application of let-7/miR-98 family in preparation of medicament for treating disease related to FAS (Fatty Acid Synthase) gene

Active Publication Date: 2011-05-04
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is also a lack of clear understanding of the functions of miRNAs of the let-7 / miR-98 family

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of let-7/miR-98 family in preparation of medicament for treating disease related to FAS (Fatty Acid Synthase) gene
  • Application of let-7/miR-98 family in preparation of medicament for treating disease related to FAS (Fatty Acid Synthase) gene
  • Application of let-7/miR-98 family in preparation of medicament for treating disease related to FAS (Fatty Acid Synthase) gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Computer Predicted Target of Example 1 miR-98

[0038] Computer prediction analysis of the binding sites of miR-98 and miR-23:

[0039] miR-23 is a microRNA associated with neuronal growth. Bioinformatics TargetScan (http: / / www.targetscan.org) analysis shows that let-7 / miR-98 and miR-23a / b can regulate the expression of FAS gene, and their binding sites exist in the 3'UTR two of FAS gene respectively. Stem-loop junctions and stem parts of the secondary structure (see figure 1 ). figure 1 The binding sites between let-7 / miR-98 and miR-23 and the secondary structure of the 3'UTR of the FAS gene are shown. The binding site between let-7 / miR-98 and the secondary structure of the 3'UTR of the FAS gene exists in the stem-loop junction region of the secondary structure of the 3'UTR of the FAS gene, while the binding site between miR-23 and the secondary structure of the 3'UTR of the FAS gene The site exists in the stem region of the secondary structure of the 3'UTR of the ...

Embodiment 2

[0040] Example 2. Flow cytometric analysis of the impact of microRNA on the FAS protein

[0041] (1) Cell culture: Hela cells Hela cells were obtained from the American Culture Collection (ATCC) and purchased from the Institute of Cells, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. Cultured with DMEM plus 10% fetal bovine serum and 100U / ml penicillin-streptomycin, 37°C, 5% CO 2 Incubate and change the medium once every 2-3 days.

[0042] (2) Cell transfection: the day before transfection, 2×10 5 The cells were evenly seeded in a 6-well cell culture plate. The coverage rate of the cells in each well should be 30-50% when transfected the next day; use Lipofectamine 2000 Reagent (Invitrogen Company) to transfect miR-98, miR-23a / b mock nucleic acid and inhibitory nucleic acid, and control. These nucleic acid sequences are as follows:

[0043] Hsa-miR-98 simulated nucleic acid (double strand): 5'UGAGGUAGUAAGUUGUAUUGUU3'

[0044] ...

Embodiment 3

[0062] Effect of embodiment 3miR-98 on FAS gene expression

[0063] As described in Example 2, miR-98 mimetic nucleic acid was transfected in Hela cells to increase the expression of miR-98, and miR-98 inhibitory nucleic acid was transfected to inhibit the function of miR-98. After 48 hours, polymerase chain reaction (RT-PCR) was used to study the effect of miR-98 on endogenous FAS mRNA.

[0064] (1) RT-PCR quantification of miR-98:

[0065]miR-98 reverse transcription primer and Real-time PCR reaction probe were directly purchased from ABI (Applied Biosystems). Target gene quantitative primers Ribosomal protein L13a (RPL13A) was used as an internal reference gene, and the primers for the amplification template were designed with Oligo 6.71 software as follows: FAS sense strand 5′accaaggttctcatgaatctcc3′, antisense strand 5′tgactccagcaatagtggtgata3′; synthesis. RPL13A primer sense strand 5'CCTGGAGGAGAAGAGGAAAGAGA3', antisense strand 5'TTGAGGACCCTCTGTGTATTTGTCAA 3' were also...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a let-7 / miR-98 family in preparation of a medicament for treating diseases related to an FAS (Fatty Acid Synthase) gene.

Description

technical field [0001] The present invention relates to the field of molecular biology, specifically to the field of gene therapy, and more specifically to the application of the let-7 / miR-98 family in the preparation of drugs for treating FAS gene-related diseases. Background technique [0002] Fas (also known as CD95) is a cell membrane surface molecule, and Fas and FasL exist as membrane molecules or soluble molecules. The combination of Fas and FasL can cause Fas-positive cells to undergo apoptosis, and this signaling pathway is regulated by many factors inside and outside cells. Fas, FasL and related regulatory factors constitute the Fas system, which has important biological functions, especially in the development, differentiation and maturation of the immune system and the maintenance of its functional stability. When the Fas system malfunctions, activated T cells will accumulate in the body, causing autoimmune diseases. lpr is the MRL strain of Fas gene coding del...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61P19/02A61P19/04A61P35/00A61P37/02
Inventor沈南唐元家王树军崔慧娟赵遐
OwnerSHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI