D-carbamoyl hydrolase mutant
A carbamoylase and mutant technology, which is applied in the field of new D-carbamylhydrolase mutants, can solve the problems of poor stability and solubility of DCase, and achieve the effect of improving stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment one: the acquisition of DCase-E6 mutant
[0041] The soluble expression level of the mutant enzyme DCase-M3(A18T / Y30N / K34E) derived from R.pieteri CGMCC1596 was significantly increased, and 7 stability-related mutation sites and corresponding mutants were obtained on the basis of it: F7(Q12L), C8(E22G / T262A), F8(A36V), B3(A36E), C6(A164T), A8(T263S), E2(H248Q) (Hong YU et al., Appl.Microbiol.Biotechnol.DOI10.1007 / s00253-008-1748-z, 2009 and Chinese patent application 200810035067.3). The present invention uses them as templates for DNA shuffling (Crameri et al., 1998; Ness et al., 2002; Stemmer, 1994), and obtains highly stable mutants through thermostability screening.
[0042] Specifically, the following primer pairs were synthesized:
[0043] pet_DC_M3_UGCTTTCAGAGTTCCGCGATCA (SEQ ID NO: 27)
[0044] pet_DC_M3_D TATGACACGTCAGATGATACTTGC (SEQ ID NO: 28)
[0045] The genes of DCase mutants F7, C8, F8, B3, C6, A8, E2 were amplified with the above primer p...
Embodiment 2
[0053] Embodiment two: the acquisition of DCase-B5 mutant
[0054] Using the coding sequence of DCase-E6 obtained in Example 1 (SEQ ID NO: 1) as a template, the following mutations were produced by site-directed mutagenesis: Q23L, V40A, H58Y, G75S, C243A, C279A, A302C, A222C, M220L, M184L, M239L, M244L, M5L, M73L, N173A, P295C, F304C, Q12L, E22G, A36V, A164T or T263S.
[0055] Then, using the obtained coding sequence of each mutant as a template, DNA shuffling and screening were carried out according to the method described in Example 1. The difference is that the high-temperature inactivation treatment after the induced expression of the transformant is: freezing at -70°C for 1 hour, heat shock at 55°C for 5 minutes, and heat treatment at 70°C for 15 minutes. Thus, another DCase mutant was screened, which was 10°C higher than the initial enzyme (DCase-M3) and 2°C higher than the starting enzyme DCase-E6 (see figure 2 ). Compared with the original enzyme, the specific acti...
Embodiment 3
[0056] Example 3: Semi-rational design of DCase-mutants based on enzyme structure consensus method (structure guided consensus concept)
[0057] Using the DCase amino acid sequence of Rorestonia CGMCC1596 as a survey template, the protein sequence alignment (p-Blast) was carried out through the PDB database, and the homology of DCase sequences from various sources was 34-99%. Import the amino acid homologous alignment results into the database (http: / / coot.embl.de / Alignment / consensus.html) for amino acid synonymous analysis. Set the synonymous value to 70%, and determine the synonymous amino acid at each position on DCase according to the survey results and the synonymous alignment table, and determine the amino acid synonymous site. Using the mutant DCase-B5 obtained in Example 2 as a template, make site-directed mutation or half-saturation mutation at the corresponding site (that is, use a degenerate primer to introduce any one of the synonymous amino acids to construct a sm...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


