Unlock instant, AI-driven research and patent intelligence for your innovation.

D-carbamoyl hydrolase mutant

A carbamoylase and mutant technology, which is applied in the field of new D-carbamylhydrolase mutants, can solve the problems of poor stability and solubility of DCase, and achieve the effect of improving stability

Inactive Publication Date: 2013-07-10
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the immobilized double-enzyme process, the stability and solubility of DCase are not good, which has become a restrictive factor for the preparation of D-HPG by the immobilized enzyme method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • D-carbamoyl hydrolase mutant
  • D-carbamoyl hydrolase mutant
  • D-carbamoyl hydrolase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment one: the acquisition of DCase-E6 mutant

[0041] The soluble expression level of the mutant enzyme DCase-M3(A18T / Y30N / K34E) derived from R.pieteri CGMCC1596 was significantly increased, and 7 stability-related mutation sites and corresponding mutants were obtained on the basis of it: F7(Q12L), C8(E22G / T262A), F8(A36V), B3(A36E), C6(A164T), A8(T263S), E2(H248Q) (Hong YU et al., Appl.Microbiol.Biotechnol.DOI10.1007 / s00253-008-1748-z, 2009 and Chinese patent application 200810035067.3). The present invention uses them as templates for DNA shuffling (Crameri et al., 1998; Ness et al., 2002; Stemmer, 1994), and obtains highly stable mutants through thermostability screening.

[0042] Specifically, the following primer pairs were synthesized:

[0043] pet_DC_M3_UGCTTTCAGAGTTCCGCGATCA (SEQ ID NO: 27)

[0044] pet_DC_M3_D TATGACACGTCAGATGATACTTGC (SEQ ID NO: 28)

[0045] The genes of DCase mutants F7, C8, F8, B3, C6, A8, E2 were amplified with the above primer p...

Embodiment 2

[0053] Embodiment two: the acquisition of DCase-B5 mutant

[0054] Using the coding sequence of DCase-E6 obtained in Example 1 (SEQ ID NO: 1) as a template, the following mutations were produced by site-directed mutagenesis: Q23L, V40A, H58Y, G75S, C243A, C279A, A302C, A222C, M220L, M184L, M239L, M244L, M5L, M73L, N173A, P295C, F304C, Q12L, E22G, A36V, A164T or T263S.

[0055] Then, using the obtained coding sequence of each mutant as a template, DNA shuffling and screening were carried out according to the method described in Example 1. The difference is that the high-temperature inactivation treatment after the induced expression of the transformant is: freezing at -70°C for 1 hour, heat shock at 55°C for 5 minutes, and heat treatment at 70°C for 15 minutes. Thus, another DCase mutant was screened, which was 10°C higher than the initial enzyme (DCase-M3) and 2°C higher than the starting enzyme DCase-E6 (see figure 2 ). Compared with the original enzyme, the specific acti...

Embodiment 3

[0056] Example 3: Semi-rational design of DCase-mutants based on enzyme structure consensus method (structure guided consensus concept)

[0057] Using the DCase amino acid sequence of Rorestonia CGMCC1596 as a survey template, the protein sequence alignment (p-Blast) was carried out through the PDB database, and the homology of DCase sequences from various sources was 34-99%. Import the amino acid homologous alignment results into the database (http: / / coot.embl.de / Alignment / consensus.html) for amino acid synonymous analysis. Set the synonymous value to 70%, and determine the synonymous amino acid at each position on DCase according to the survey results and the synonymous alignment table, and determine the amino acid synonymous site. Using the mutant DCase-B5 obtained in Example 2 as a template, make site-directed mutation or half-saturation mutation at the corresponding site (that is, use a degenerate primer to introduce any one of the synonymous amino acids to construct a sm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a D-carbamoyl hydrolase mutant with high stability (especially improved thermal stability) and application thereof.

Description

technical field [0001] The present invention belongs to the field of enzymology. In particular, the present invention relates to novel D-carbamoylase mutants. Background technique [0002] D-p-hydroxyphenylglycine (D-HPG) as the side chain, is a variety of semi-synthetic broad-spectrum β-lactams such as amoxicillin (Amoxicillin) and cefadroxil (Cefadroxil) It is an important intermediate of antibiotics, insecticides and sweetener intermediates, and has wide application value and important commercial value. [0003] D-HPG can be prepared by chemical hydrolysis, bacterial transformation and immobilized enzymes and other methods. Toxic substances such as HNO are involved in chemical hydrolysis 2 The use and racemate chiral resolution and other processes, so the total yield of the reaction is not high and the energy consumption is large. The bacterial transformation method shows slow transformation reaction process and accumulation of intermediate carbamoyl-D-hydroxyphenylgl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/78C12N15/55C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12P13/04
Inventor 杨晟张大龙姜卫红杨蕴刘陶荣盛范文超
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI