Chrysanthemum anti-retroelement DgZFP1, plant expression vector thereof, construction method thereof and application thereof
An anti-retro transcription factor and plant expression vector technology, applied in the field of molecular biology, can solve problems such as low efficiency and huge water resource consumption, and achieve the effects of improving salt tolerance, improving plant salt tolerance, and improving plant varieties.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] Plant expression vector pCAMBIA 1301- DgZFP1 build
[0040] 1. DgZFP1 A clone of:
[0041]Choose the chrysanthemum 'Zhongshan Zigui' as the material, choose healthy cuttings, cut the surviving seedlings (20 days) in 200mM NaCl continuous stress treatment for 7 days, take 0.05g young leaves, refer to Trizol RNA extraction kit (TaKaRa) According to the method described in the manual, total RNA was extracted from leaves, and 1 μg of total RNA was reverse-transcribed into cDNA according to the M-MLV Reverse Transcription Kit (TaKaRa), and the cDNA product was digested with RNase. Capsicum annuum The sequence information of cys2 / his2-type zinc finger transcription factor (NCBI accession number: AY196704), analyzed and designed primer amplification by Primer 5 software DgZFP1 ;
[0042] Upstream primer DgZFP1-F: 5′- ATGGCAGTTGAAGCTCTAAACTCAC -3′
[0043] Downstream primer DgZFP1-R: 5′- ATGTTGTGTCGGGATCTCGAGCTTT -3′
[0044] Using the extracted leaf cDNA as a template...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap