Unlock instant, AI-driven research and patent intelligence for your innovation.

Rabies virus glycoprotein-derived peptide and application thereof

A rabies virus and glycoprotein technology, applied in the field of biomedicine, can solve problems such as brain infection, increase the penetration of drugs through the blood-brain barrier, and surgical injuries, so as to improve the therapeutic effect and have a good development and application prospect

Inactive Publication Date: 2011-09-07
SOUTHWEST UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] There are three main types of brain-targeted drug delivery methods: one is invasive direct drug delivery, including hyperosmotic shock, carotid artery injection of vasoactive substances, and intrathecal or intraventricular injection, but this method is prone to brain infection And surgical injury, which is obviously invasive to the brain; the second is to increase the ability of drugs to penetrate the blood-brain barrier, but this method has high requirements on the physical and chemical properties of the drug itself, which has relatively large limitations; Carrier-mediated drug transport for targeted drug delivery can increase the targeted uptake of drugs in the brain and greatly reduce invasive damage to the brain. However, there is no ideal brain that can carry bioactive macromolecules. targeted drug carrier

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rabies virus glycoprotein-derived peptide and application thereof
  • Rabies virus glycoprotein-derived peptide and application thereof
  • Rabies virus glycoprotein-derived peptide and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1, RDP-mediated brain-targeted transport of β-Gal

[0022] The amino acid sequence of the RDP used in this embodiment is MGKSVRTWNEIIPSKGCLRVGGRCHPH VNGGG-RRRRRRRR (SEQ ID No.1), which is obtained by linking the carboxy-terminal of the 330th to 357th peptide (underlined part) of RVG with nona-arginine through the connecting peptide VNGGG, is named RDP1.

[0023] 1. Preparation of fusion protein RDP-β-Gal

[0024] 1. Construction of recombinant plasmid pET28a(+)-RDP-β-Gal

[0025] The schematic diagram of the construction of the recombinant plasmid pET28a(+)-RDP-β-Gal is shown in figure 1 shown.

[0026] First, design and synthesize RDP1 cDNA, the nucleotide sequence is as follows: ata ccatgg gcaaaagcgtgcgtacctggaat-gaaattatcccgagcaaaggctgcctgcgtgtgggtggccgttgccatccgcatgtgaatggtggcggtcgtcgccgtcgccgtcgccgtcgccgt gtcgac at (SEQ ID No.3, the underlined parts are NcoI and SalI restriction sites respectively), the synthesized cDNA was double-digested with ...

Embodiment 2

[0039] Example 2, RDP-mediated brain-targeted transport of EGFP

[0040] The amino acid sequence of the RDP used in this embodiment is MGCDIFTKSRGKRASKGSETCGFVDER GGGG-RRRRRRRR (SEQ ID No.2), which is obtained by linking the carboxy-terminal of the 189th to 214th peptide (underlined part) of RVG with nona-arginine through the connecting peptide GGGG, is named RDP2.

[0041] 1. Preparation of fusion protein RDP-EGFP

[0042] 1. Construction of recombinant plasmid pET28a(+)-RDP-EGFP

[0043] First, design and synthesize RDP2 cDNA, the nucleotide sequence is as follows: ata ccatgg gcaaaagcgtgcgtacctggaatgaaattat cccgagcaaaggctgcctgcgtgtgggtggccgttgccatccgcatgtgaatggtggcggtcgtcgccgtcgccgtcgccgtcgccgt gtcgac att (SEQ ID No.4, the underlined parts are NcoI and SalI restriction sites respectively), the synthesized cDNA was double-digested with restriction endonucleases NcoI and SalI, and then combined with the plasmid that was also double-digested with NcoI and SalI pET28a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedicine, and relates to a rabies virus glycoprotein-derived peptide and application thereof. The rabies virus glycoprotein-derived peptide is obtained by connecting the carboxyl terminal of a peptide fragment from a 189th position to a 214th position or a 330th position to a 357th position of a rabies virus glycoprotein with nine arginines through a connecting peptide, can quickly and specifically carry bioactive macromolecules such as proteins and the like to pass through a blood brain barrier so as to realize brain targeted medicine delivery, and can be used for preparing a brain targeted medicine delivery carrier; therefore, a high-efficiency, safe and non-invasive method is provided for the brain targeted delivery of the bioactive macromolecules and other active micromolecules which difficultly pass through the blood brain barrier, the treatment effect on brain diseases is enhanced, and the rabies virus glycoprotein-derived peptide has good development and application prospects in fields of research and development of new medicines for the brain diseases, and clinical treatment of the brain diseases.

Description

technical field [0001] The invention belongs to the field of biomedicine and relates to a polypeptide and its application, in particular to a rabies virus glycoprotein-derived peptide (RDP) and its application in pharmaceuticals. Background technique [0002] Brain diseases such as senile dementia, brain tumors, and mental diseases are increasing day by day, seriously threatening human health. One of the bottlenecks in the treatment of brain diseases is the blood-brain barrier. More than 95% of the bioactive macromolecules with therapeutic potential, such as proteins and nucleic acids, cannot enter the brain through the blood-brain barrier and cannot exert therapeutic effects. In addition, an important problem that needs to be solved in the treatment of brain diseases is how to achieve brain-targeted drug delivery, so as to reduce the great side effects caused by systemic drug delivery. [0003] There are three main types of brain-targeted drug delivery methods: one is inva...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00A61K47/42A61K47/64
Inventor 付爱玲徐兴然胡昌华李晓荣
Owner SOUTHWEST UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More