Rabies virus glycoprotein-derived peptide and application thereof
A rabies virus and glycoprotein technology, applied in the field of biomedicine, can solve problems such as brain infection, increase the penetration of drugs through the blood-brain barrier, and surgical injuries, so as to improve the therapeutic effect and have a good development and application prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1, RDP-mediated brain-targeted transport of β-Gal
[0022] The amino acid sequence of the RDP used in this embodiment is MGKSVRTWNEIIPSKGCLRVGGRCHPH VNGGG-RRRRRRRR (SEQ ID No.1), which is obtained by linking the carboxy-terminal of the 330th to 357th peptide (underlined part) of RVG with nona-arginine through the connecting peptide VNGGG, is named RDP1.
[0023] 1. Preparation of fusion protein RDP-β-Gal
[0024] 1. Construction of recombinant plasmid pET28a(+)-RDP-β-Gal
[0025] The schematic diagram of the construction of the recombinant plasmid pET28a(+)-RDP-β-Gal is shown in figure 1 shown.
[0026] First, design and synthesize RDP1 cDNA, the nucleotide sequence is as follows: ata ccatgg gcaaaagcgtgcgtacctggaat-gaaattatcccgagcaaaggctgcctgcgtgtgggtggccgttgccatccgcatgtgaatggtggcggtcgtcgccgtcgccgtcgccgtcgccgt gtcgac at (SEQ ID No.3, the underlined parts are NcoI and SalI restriction sites respectively), the synthesized cDNA was double-digested with ...
Embodiment 2
[0039] Example 2, RDP-mediated brain-targeted transport of EGFP
[0040] The amino acid sequence of the RDP used in this embodiment is MGCDIFTKSRGKRASKGSETCGFVDER GGGG-RRRRRRRR (SEQ ID No.2), which is obtained by linking the carboxy-terminal of the 189th to 214th peptide (underlined part) of RVG with nona-arginine through the connecting peptide GGGG, is named RDP2.
[0041] 1. Preparation of fusion protein RDP-EGFP
[0042] 1. Construction of recombinant plasmid pET28a(+)-RDP-EGFP
[0043] First, design and synthesize RDP2 cDNA, the nucleotide sequence is as follows: ata ccatgg gcaaaagcgtgcgtacctggaatgaaattat cccgagcaaaggctgcctgcgtgtgggtggccgttgccatccgcatgtgaatggtggcggtcgtcgccgtcgccgtcgccgtcgccgt gtcgac att (SEQ ID No.4, the underlined parts are NcoI and SalI restriction sites respectively), the synthesized cDNA was double-digested with restriction endonucleases NcoI and SalI, and then combined with the plasmid that was also double-digested with NcoI and SalI pET28a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
