Cotton flowering locus T GhFT and vector, construction body, cell and polypeptide thereof

A technology of florigen and cotton, applied in genetic engineering, plant genetic improvement, using vectors to introduce foreign genetic material, etc., can solve the problems of FT homologous gene cloning and functional research in cotton that have not been reported

Inactive Publication Date: 2011-09-14
SHIHEZI UNIVERSITY
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Cotton is one of the important economic crops, but there are no ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton flowering locus T GhFT and vector, construction body, cell and polypeptide thereof
  • Cotton flowering locus T GhFT and vector, construction body, cell and polypeptide thereof
  • Cotton flowering locus T GhFT and vector, construction body, cell and polypeptide thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Cloning and Analysis of GhFT Gene CDS

[0037] According to the published amino acid sequence of the flowering locus T gene FT (Flowering locus T) in the Columbia (Col) ecotype Arabidopsis thaliana, the accession number is AAF03926.1, in GenBanK (www.ncbi.nlm.nih.gov) Download the sequence, use the sequence as a probe (query), select the cotton ESTs database, run the tBlastx program, and search for a cotton homologous ESTs sequence, the accession number is UFL_438_68 (ES826802).

[0038] According to the nucleotide sequence of the EST sequence, design primers: Kpn I-GhFT-F: GGGGTACC ATGCCTAGAGACAGAGATCCTTTGGT, see SEQ ID NO: 3; XbaI-GhFT-R: GCTCTAGA TCATGTCCTACGGCCACCGGATCCACT, see SEQ ID NO: 4 (the underlined part is Kpn I and Xba I restriction site). Using the cDNA of the leaves of Xinluzao 33, an upland cotton variety in Xinjiang, as a template, amplify by RT-PCR, connect the amplified output to pGEMT-easy (promega), construct pGEMT::GhFT, and transfor...

Embodiment 2

[0041] Example 2: Tissue expression analysis of GhFT gene

[0042] (1) Experimental method

[0043] The roots, hypocotyls, flowers, true leaves, fibers, and ovules of Xinluzao 33 were collected and quick-frozen in liquid nitrogen, and the total RNA was extracted by the CTAB method. Transfer to CTAB extraction buffer (2% CTAB, 2% polyvinylpyrrolidone PVP, 100mmol / L Tris-HCl, 25mmol / L EDTA, 2.0mol / L NaCl, 2% mercapto ethanol), mix well and then 65°C water bath for 10min, shake 2-3 times during this period; 2) 4°C, 12000rpm / min, 10min; 3) Slowly absorb the supernatant, add an equal volume of phenol:chloroform:isoamyl Alcohol = 25:24:1 extraction once, shake vigorously and place at room temperature for 5 minutes; 4) 4°C, 12000rpm / min, 10 minutes; 5) Slowly absorb the supernatant, add an equal volume of chloroform for extraction twice, fully shake each time , and placed at room temperature for 5min; 6) 4°C, 12000rpm / min, 10min; 7) Take the supernatant, add 1 / 3 volume of 8mol / L Li...

Embodiment 3

[0046] Example 3: Gene Transformation

[0047] Through genetic transformation in Arabidopsis thaliana, the regulatory effect of cotton GhFT gene on plant flowering was studied.

[0048] 1. Experimental method

[0049] (1) Construction of the carrier

[0050] p35S::GhFT vector: The correctly sequenced plasmid pGEM T::GhFT was digested with Kpn I and Xba I, and the recovered fragment was connected to the plasmid pCAMBIA2300 that had been digested with the same double enzymes to construct the vector: p35S::GhFT.

[0051] p35S::GhFT-GFP vector: first use primers 5'- GGGGTACC ATGCCTAGAGACAGAGATCCTTTGGT-3' (see SEQ ID NO: 7) and 5'- TCTAGA TGTCCTACGGCCACCGGATCCACT-3' (see SEQ ID NO: 8) (the underlined parts are BamH I and Xba I restriction sites respectively), use pGEM T::GhFT plasmid DNA as a template to amplify the CDS region of the GhFT gene, and connect it to the vector pGEM Teasy (promega), after the correct sequence of the plasmid, it was digested by BamH I and Xba I, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to cotton flowering locus T GhFT and a vector, a construction body, a cell and polypeptide thereof, in particular to cotton flowering locus T and application thereof. In the invention, the flowering locus T GhFT1 of upland cotton mainly cultivated in Xinjiang is cloned, and the adjustment effect of the gene on the flowering of plants is researched. The invention also relatesto a vector, a host cell and a plant which comprise the gene. Due to the adoption of the gene, the flowering time of the plant can be advanced or the shape and the property of the plant can be improved.

Description

technical field [0001] The invention relates to cotton florigen gene GhFT and its carrier, construct, cell and polypeptide. The gene can be used to promote early flowering of plants or improve the traits of plants. Background technique [0002] Flowering is an extremely important trait of plants. It affects the growth period of crops and then affects the yield and quality, so it has always been concerned. Flowering is an important physiological phenomenon of flowering plants, and it is an important developmental process in which plants transform from vegetative growth to reproductive growth. At present, it is generally believed that there are four main pathways for plant flowering, including photoperiod pathway, autonomous pathway, vernalization pathway, and gibberellin pathway. In recent years, with the development of molecular biology, many key genes of these pathways have been cloned, and further research on their functions has well analyzed the physiological and molecu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C07K14/415
Inventor 黄先忠崔百明东锐郑银英
Owner SHIHEZI UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap