Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus
A cowpea mosaic virus, RT-PCR technology, applied in microorganism-based methods, biochemical equipment and methods, microorganisms and other directions, can solve problems such as no RT-PCR detection methods, and achieve fast and accurate detection methods and universal primers. good effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] 1. Primer design and synthesis
[0016] According to cycad necrotic dwarf virus (CNSV), grape chrome mosaic virus (GCMV), GFLV, black currant retrograde virus (BRV), RaMV, SqMV, BPMV, RCMV, CPMV, CPSMV, BBWV1 , broad bean wilt virus No. 2 (BBWV2), ArMV, TRSV, GFLV, RpRSV, TBRV, beet ringspot virus (BRSV), PRMV, ToRSV virus RNA1 genome sequence design primers, the primer sequence is:
[0017] SEQ ID No.1 (upstream): 5'-TGTGAYTAYWVNVVNTTYGATGG-3';
[0018] SEQ ID No. 2 (downstream): 5'-YTTRTCHBTVCCATCVGTAAT-3'.
[0019] For the convenience of sequencing, universal sequencing primers BCABESTTM Sequencing Primer RV-M and M13-47 (underlined) were respectively introduced into the primers. The primer sequences are:
[0020] SEQ ID No.1 (Comov-sf-F2): 5′- GAGCGGATAACAATTTCACACAGG TGTGAYTAYWVNVVNTTYGATGG-3′
[0021] SEQ ID No.2 (Comov-sf-R2): 5′- CGCCAGGGTTTTTCCCAGTCACGAC YTTRTCHBTVCCATCVGTAAT-3′
[0022] 2. Extraction of total RNA
[0023] 1) Take 0.1 g of diseased pla...
Embodiment 2
[0034] Versatile detection of a common RT-PCR method for Comovirinae
[0035] Arabidopsis mosaic virus (ArMV), tobacco ringspot virus (TRSV), tomato ringspot virus (ToRSV), cherry leafroll virus (CLRV), tobacco black ring virus (TBRV), peach bush mosaic virus (PRMV) ), grape fan leaf virus (GFLV), rubus ringspot virus (RpRSV), black rice leaf mottle virus (BLMoV), bean pod mottle virus (BPMV), cowpea mosaic virus (CPMV), cowpea heavy mosaic virus ( CPSMV), broad bean staining virus (BBSV), squash mosaic virus (SqMV), red clover mottle virus (RCMV), radish mosaic virus (RaMV), broad bean wilting virus 1 (BBWV1) and other 17 viruses and 24 isolates Diseased leaves, total RNA was extracted respectively according to the method of Example 1, then RT-PCR amplification was carried out according to the method of Example 1, and the results were detected by agarose gel electrophoresis. Results DNA fragments of 407-451 bp were detected in the leaves infected with the virus. Test result...
Embodiment 3
[0037] Specific Detection of Comovirinae with Universal RT-PCR Method
[0038] Get the healthy leaves of plants such as cattail melon, common tobacco leaf, tomato, cucumber, pumpkin, magpie bean, broad bean, cowpea, watermelon, lily, extract total RNA respectively according to the method of Example 1, and then carry out RT-PCR according to the method of Example 1 Amplified for specific detection. Test results such as figure 2 shown. It shows that the established general RT-PCR method does not cross-react with the host plant of the virus, has good specificity, and meets the detection requirements.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 