Unlock instant, AI-driven research and patent intelligence for your innovation.

Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus

A cowpea mosaic virus, RT-PCR technology, applied in microorganism-based methods, biochemical equipment and methods, microorganisms and other directions, can solve problems such as no RT-PCR detection methods, and achieve fast and accurate detection methods and universal primers. good effect

Inactive Publication Date: 2013-05-01
INSPECTION & QUARANTINE TECH CENT OF XIAMEN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2004, Maliogka et al established the cowpea mosaic virus family ( Comoviridae ) (that is, the current Cowpea mosaic virus subfamily) virus nested RT-PCR for general detection, but there is no conventional general RT-PCR detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus
  • Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus
  • Degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] 1. Primer design and synthesis

[0016] According to cycad necrotic dwarf virus (CNSV), grape chrome mosaic virus (GCMV), GFLV, black currant retrograde virus (BRV), RaMV, SqMV, BPMV, RCMV, CPMV, CPSMV, BBWV1 , broad bean wilt virus No. 2 (BBWV2), ArMV, TRSV, GFLV, RpRSV, TBRV, beet ringspot virus (BRSV), PRMV, ToRSV virus RNA1 genome sequence design primers, the primer sequence is:

[0017] SEQ ID No.1 (upstream): 5'-TGTGAYTAYWVNVVNTTYGATGG-3';

[0018] SEQ ID No. 2 (downstream): 5'-YTTRTCHBTVCCATCVGTAAT-3'.

[0019] For the convenience of sequencing, universal sequencing primers BCABESTTM Sequencing Primer RV-M and M13-47 (underlined) were respectively introduced into the primers. The primer sequences are:

[0020] SEQ ID No.1 (Comov-sf-F2): 5′- GAGCGGATAACAATTTCACACAGG TGTGAYTAYWVNVVNTTYGATGG-3′

[0021] SEQ ID No.2 (Comov-sf-R2): 5′- CGCCAGGGTTTTTCCCAGTCACGAC YTTRTCHBTVCCATCVGTAAT-3′

[0022] 2. Extraction of total RNA

[0023] 1) Take 0.1 g of diseased pla...

Embodiment 2

[0034] Versatile detection of a common RT-PCR method for Comovirinae

[0035] Arabidopsis mosaic virus (ArMV), tobacco ringspot virus (TRSV), tomato ringspot virus (ToRSV), cherry leafroll virus (CLRV), tobacco black ring virus (TBRV), peach bush mosaic virus (PRMV) ), grape fan leaf virus (GFLV), rubus ringspot virus (RpRSV), black rice leaf mottle virus (BLMoV), bean pod mottle virus (BPMV), cowpea mosaic virus (CPMV), cowpea heavy mosaic virus ( CPSMV), broad bean staining virus (BBSV), squash mosaic virus (SqMV), red clover mottle virus (RCMV), radish mosaic virus (RaMV), broad bean wilting virus 1 (BBWV1) and other 17 viruses and 24 isolates Diseased leaves, total RNA was extracted respectively according to the method of Example 1, then RT-PCR amplification was carried out according to the method of Example 1, and the results were detected by agarose gel electrophoresis. Results DNA fragments of 407-451 bp were detected in the leaves infected with the virus. Test result...

Embodiment 3

[0037] Specific Detection of Comovirinae with Universal RT-PCR Method

[0038] Get the healthy leaves of plants such as cattail melon, common tobacco leaf, tomato, cucumber, pumpkin, magpie bean, broad bean, cowpea, watermelon, lily, extract total RNA respectively according to the method of Example 1, and then carry out RT-PCR according to the method of Example 1 Amplified for specific detection. Test results such as figure 2 shown. It shows that the established general RT-PCR method does not cross-react with the host plant of the virus, has good specificity, and meets the detection requirements.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a degenerate primer, detection method and application for general RT-PCR detection of comovirinae subvirus. The degenerate primer consists of a forward degenerate primer of following sequence: SEQ ID No.1:5'-TGTGAYTAYWVNVVNTTYGATGG-3' and a reverse degenerate primer of following sequence: SEQ ID No.2:5' -YTTRTCHBTVCCATCVGTAAT-3', wherein, Y,C,T,W,A,G,N,R,B and H satisfy the following relation: Y=C / T, W=A / T, V=G / A / C, N=A / G / C / T, R=A / G, B=G / T and H=A / T / C. The primer disclosed in the invention has good versatility, and the detection method is accurate and rapid, providing a guarantee of security of import and export.

Description

technical field [0001] The invention relates to a degenerate primer for universal RT-PCR detection of cowpea mosaic virus subfamily virus, a detection method and application thereof. Background technique [0002] Cowpea mosaic virus subfamily ( Comovirinae ) belonging to the order Picornaviridae ( Picornavirales ), associated Vignaviridae ( Secoviridae ) in a subfamily that includes the genus Comovirus ( Comovirus ), Fabavirus ( Fabavirus ) and nematode-transmitted polyhedrviruses ( Nepovirus ) and other 3 virus genera, a total of 53 viruses. Cowpea mosaic virus subfamily virus is a kind of virus that poses an important threat to agricultural production safety. Many viruses have a very wide host range and can cause serious losses to a variety of crops. According to the "List of Imported Plant Quarantine Pests of the People's Republic of China" published in 2007, the species listed as quarantine viruses in this virus subfamily are: Arabidopsis mosaic virus ( Arab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/94
Inventor 廖富荣黄蓬英林石明
Owner INSPECTION & QUARANTINE TECH CENT OF XIAMEN ENTRY EXIT INSPECTION & QUARANTINE BUREAU