Mycoplasma ovipneumoniae Hsp70 (DnaK) C terminal gene recombinant plasmid

A technology of mycoplasma pneumoniae and gene recombination, applied in the research fields of microbiology, molecular biology and genetic engineering

Inactive Publication Date: 2011-11-16
NINGXIA UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the complete genome sequence of Mycoplasma ovis pneumoniae has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycoplasma ovipneumoniae Hsp70 (DnaK) C terminal gene recombinant plasmid
  • Mycoplasma ovipneumoniae Hsp70 (DnaK) C terminal gene recombinant plasmid
  • Mycoplasma ovipneumoniae Hsp70 (DnaK) C terminal gene recombinant plasmid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] 1. Cloning of MO Hsp70C-terminal gene

[0023] The following primers were designed and synthesized according to MO hsp70 gene sequence and primer design principles: P2: GGGGTCGACTTAATTTTGTTTGATTTC; P3: CAGGGATCCACTCCTTTAACTTTAGG. The shaded areas of P2 and P3 represent restriction sites of Sal I and BamH I, respectively.

[0024] Using PCR technology, using P2 and P3 as primers, and T-Hsp70 plasmid (containing the full-length cDNA sequence of MO Hsp70) as a template, the 700bp fragment of the Hsp70C terminal gene was amplified (see figure 1 ).

[0025] 2. Construction of prokaryotic expression vector of MO Hsp70C terminal gene

[0026] The Hsp70 C-terminal gene amplification product and the expression vector pET28a(+) were digested with Sal I and BamH I respectively, purified and recovered with Wizard PCR preps DNA Purification System Kit, then ligated with T4 DNA Lingase, and left overnight at 4°C. The ligation product was transformed into DH(5α), and the plasmid wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses a mycoplasma ovipneumoniae Hsp70 (DnaK) C terminal gene recombinant plasmid. The production method is that: first, the following primers are designed and synthesized: P2: GGGGTCGACTTAATTTTGTTTGATTTC; P3: CAGGGATCCACTCCTTTAACTTTAGG; then a plasmid T-Hsp70 is adopted as a model, and PCR (polymerase chain reaction) amplification is carried out with the primers P2 and P3, such that a Hsp70C terminal gene cDNA segment is obtained, wherein a size of the segment is 700bp; the segment is connected to pET28a(+), such that a recombinant plasmid pET28a(+)-Hsp70C is obtained; the recombinant plasmid is further transformed into BL21(DE3), and SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) is carried out upon an expression product, such that a target protein with a size of approximately 29kDa is obtained.

Description

technical field [0001] The invention belongs to the research fields of microbiology, molecular biology and genetic engineering, and relates to related experimental methods and technologies of microbiology, molecular biology and genetic engineering, in particular to a recombinant plasmid of the Hsp70 (DnaK) C-terminal gene of Mycoplasma ovis pneumoniae. Background technique [0002] Mycoplasma ovipneumoniae (Mycoplasma ovipneumoniae, MO) can infect and harm sheep. It is the main pathogen causing sheep contagious ovine pleuropneumonia (Contagious ovine pleuropneumonia), and can also infect lambs and goats aged 1-3 months. Sheep infectious pleuropneumonia is a chronic respiratory infectious disease in sheep, mainly characterized by coughing, panting, progressive emaciation and chronic proliferative interstitial pneumonia. It is a worldwide infectious disease. [0003] Studies suggest that heat shock protein 70 (Hsp70), also known as DnaK, has a variety of biological functions, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12R1/35C12R1/19
Inventor 王玉炯李敏谢琴刘晓明马春骥徐庆春
Owner NINGXIA UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap