Mycoplasma ovipneumoniae Hsp70 (DnaK) C terminal gene recombinant plasmid
A technology of mycoplasma pneumoniae and gene recombination, applied in the research fields of microbiology, molecular biology and genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0022] 1. Cloning of MO Hsp70C-terminal gene
[0023] The following primers were designed and synthesized according to MO hsp70 gene sequence and primer design principles: P2: GGGGTCGACTTAATTTTGTTTGATTTC; P3: CAGGGATCCACTCCTTTAACTTTAGG. The shaded areas of P2 and P3 represent restriction sites of Sal I and BamH I, respectively.
[0024] Using PCR technology, using P2 and P3 as primers, and T-Hsp70 plasmid (containing the full-length cDNA sequence of MO Hsp70) as a template, the 700bp fragment of the Hsp70C terminal gene was amplified (see figure 1 ).
[0025] 2. Construction of prokaryotic expression vector of MO Hsp70C terminal gene
[0026] The Hsp70 C-terminal gene amplification product and the expression vector pET28a(+) were digested with Sal I and BamH I respectively, purified and recovered with Wizard PCR preps DNA Purification System Kit, then ligated with T4 DNA Lingase, and left overnight at 4°C. The ligation product was transformed into DH(5α), and the plasmid wa...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap