Check patentability & draft patents in minutes with Patsnap Eureka AI!

Molecular markers and their application to predict the efficacy of platinum-based chemotherapy in advanced non-small cell lung cancer

A technology of non-small cell lung cancer and molecular markers, applied in the field of medical molecular genetics and clinical medicine, can solve the problems of different sensitivity and curative effect of chemotherapy drugs

Active Publication Date: 2011-12-21
GENERGY BIO TECH SHANGHAI CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, from a clinical point of view, the sensitivity of different individuals to chemotherapy drugs is significantly different, and the curative effect is significantly different.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1. Molecular markers for predicting efficacy of platinum-based chemotherapy in patients with advanced NSCLC.

[0019] 1. Collection of clinical samples

[0020] The subjects of the study were 663 patients with newly diagnosed non-small cell lung cancer. The inclusion criteria are: new pathologically confirmed

[0021] Patients with non-small cell lung cancer; age over 18 years; stage IIIA-IV, with measurable lesions; no history of other malignant tumors, no previous chemotherapy, surgery and radiotherapy for non-small cell lung cancer; receiving first-line platinum-based chemotherapy; general health Status score PS 0-2; no major organ dysfunction, blood routine, liver and kidney function and heart function are basically normal; complete follow-up information can be obtained. All the subjects were unrelated Han people, geographically mainly from Shanghai and its surrounding areas. All patients received platinum-based first-line treatment for the first time.

...

Embodiment 2

[0032] Example 2. Use of detection kits.

[0033] 1. Genomic DNA extraction

[0034] Genomic DNA was extracted by the guanidine hydrochloride method.

[0035] 2. Molecular marker typing

[0036] Using the detection kit, first specifically amplify the containing ABCB11The DNA fragment of the polymorphic site of gene rs12692889, the primer sequence is as follows: forward primer-5' TCTTTGGCTGTTTGGAAATA 3' (SEQ ID NO.1); reverse primer-5' GCAACCCTTTAACCAGAAAA 3' (SEQ ID NO.2). The reaction system (20 μl) contains: 10 x Taq buffer 2 μl, 2 mM dNTP 2 μl, 1 U Taq enzyme 1 μl, sample DNA (about 50 ng) 1 μl and 5 μM PCR primer 1 μl. The amplification reaction was carried out on a PCR amplification instrument, and the reaction conditions were: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; 72°C for 7 minutes; and storage at 4°C.

[0037] The obtained DNA fragments are then sequenced. Specific steps are as follows:

[0038] PCR...

Embodiment 3

[0044] Example 3. The service of predicting the efficacy of chemotherapy for patients with advanced NSCLC.

[0045] 1. Genomic DNA extraction

[0046] Peripheral blood samples were collected, and genomic DNA was extracted by the guanidine hydrochloride method.

[0047] 2. Genotyping detection

[0048] Using the kit provided by the invention, the detection of the genome DNA of the detected ABCB11 Genome rs12692889 site for typing.

[0049] 3. Predictive analysis of the curative effect of individual platinum-containing chemotherapy

[0050] Through the analysis of the genotype of the rs12692889 locus of the tested subjects, an evaluation and analysis report for the efficacy of individual platinum-based chemotherapy is issued: if the genotype is C / C, the effective rate is 14.2%; if the genotype is C / T, the effective rate is 14.2%. The effective rate is 21.7%; if the genotype is T / T, the effective rate is 36.8%. The results can be used as a reference for physicians to adjust ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of medical molecular genetics and clinical medicine and particularly discloses a molecular marker for predicting the curative effect of platinum chemo-treatment on later non-small cell lung cancer and an application thereof. The molecular marker comprises an ABCB11 gene and mononucleotide polymorphic sites rs12692889 on the ABCB11 gene, wherein the ABCB11 gene is relevant to the curative effect of the platinum chemo-treatment on the later non-small cell lung cancer. As an application of the molecular marker, the invention also provides an ABCB11 gene polymorphism detection kit used for predicting the curative effect of the platinum chemo-treatment on non-small cell lung cancer (NSCLC) patients. The molecular marker and the detection kit can be used for detecting or predicting the curative effect of the platinum chemo-treatment on later non-small cell lung cancer patients, so the basis is provided for the realization of the individual chemo-treatment of the patients.

Description

technical field [0001] The invention belongs to the technical fields of medical molecular genetics and clinical medicine, and specifically relates to a molecular marker for predicting the curative effect of platinum-containing chemotherapy for patients with advanced non-small cell lung cancer and its application. Background technique [0002] Lung cancer is one of the most harmful malignant tumors to human health and life. More than one million people die of lung cancer every year in the world, and it is one of the main causes of death caused by tumors. Non-small cell lung cancer (NSCLC) accounts for about 80% of lung cancers, and two-thirds of the patients are already at an advanced stage when they are diagnosed and have lost the opportunity for surgery. The standard treatment of advanced NSCLC is chemotherapy-based comprehensive treatment, and platinum-based drugs are commonly used in the clinical treatment of NSCLC because of their strong anti-tumor effects. At present, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/12
Inventor 卢大儒汪海健陈红岩赵雪莹李欢
Owner GENERGY BIO TECH SHANGHAI CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More