Check patentability & draft patents in minutes with Patsnap Eureka AI!

Process for producing lactic acid bacterium having enhanced immunomodulating activity

An immunomodulation and manufacturing method technology, which is applied in the directions of microorganism-based methods, cosmetic preparations, biochemical equipment and methods, etc., can solve the problems of increased raw materials, undisclosed immunomodulatory effects, and increased processes, and achieves mild efficacy. , The effect of preventing excessive immune function and high safety

Active Publication Date: 2012-02-15
SUNTORY HLDG LTD
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the immunostimulatory effects disclosed in these patent documents are the result of in vitro or animal experiments, and the knowledge of the actual immunomodulatory effects in humans has not yet been disclosed
[0004] In addition, as a method of enhancing the immunomodulatory effect of lactic acid bacteria, there are methods of using a corn steep liquor medium (Patent Document 5), a method of using a medium containing 5 to 15% salt (Patent Document 6), and using a medium containing 0.1 ~1% surfactant and 0.01%~0.1% carbonate medium and heat treatment at 80~120°C for 5~30 minutes (Patent Document 7), but there are cost aspects such as increased raw materials and increased processes The problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for producing lactic acid bacterium having enhanced immunomodulating activity
  • Process for producing lactic acid bacterium having enhanced immunomodulating activity
  • Process for producing lactic acid bacterium having enhanced immunomodulating activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] (The concentration of lactic acid bacteria, the amount of cell wall components, and the induction of interleukin-12 changed according to the culture temperature)

[0080] Lactic acid bacteria culture and cell preparation

[0081] Lactobacillus pentosus S-PT84 (FERM BP-10028) and Lactobacillus pentosus JCM1558 T They were cultured in MRS medium at various temperatures (25°C to 43°C) for 24 hours.

[0082] After the cultivation, centrifuge at 8000rpm for 10 minutes, collect the bacterial cells, wash with physiological saline, and centrifuge again. Then, wash once with normal saline and once with ion-exchanged water, resuspend with appropriate amount of ion-exchanged water to prepare lactic acid bacteria suspension, and measure the final bacterial concentration (unit / mL). Then, it sterilized at 95 degreeC for 1 minute, and freeze-dried. After drying, the total weight was measured to calculate the number of bacteria per unit weight. In addition, Lactobacillus pentosus...

Embodiment 2

[0091] (Concentration of lactic acid bacteria changed by culture temperature, interleukin-12 induction)

[0092] Lactic acid bacteria culture and cell preparation

[0093] Lactobacillus plantarum JCM1149 T At various temperatures (30°C-38°C), Lactobacillus casei JCM1134 T They were cultured in MRS medium at various temperatures (25°C to 44°C) for 24 hours.

[0094] After the cultivation, centrifuge at 8000rpm for 10 minutes, collect the bacterial cells, wash with physiological saline, and centrifuge again. Then, wash once with normal saline and once with ion-exchanged water, resuspend with appropriate amount of ion-exchanged water to prepare lactic acid bacteria suspension, and measure the final bacterial concentration (unit / mL). Then, it sterilized at 95 degreeC for 1 minute, and freeze-dried. After drying, the total weight was measured to calculate the number of bacteria per unit weight.

[0095] In addition, Lactobacillus plantarum JCM1149 T The recommended culture ...

Embodiment 3

[0104] (Cell wall synthetase gene expression analysis and cell wall component amount changed by culture temperature)

[0105] Cell wall synthesis-related enzyme expression analysis primers

[0106] Preparation of primers for Q-RT-PCR of phospho-N-acetylmuramoyl-pentapeptide transferase (mraY), penicillin-binding protein 1A (pbp1A), and penicillin-binding protein 2A (pbp2A) based on the gene information of the genus Lactobacillus whose genome information has been published . 关于引物,作为mraY用引物,使用mraY116:aggaaggtcctaagtggca / mraY895actcgctccaacccttcat,作为pbp 1A用引物,使用pbp1A304:gccgtcgtctcaatcgaaga / pbp1A1724:gtaccagtcttaccagcttg,作为pbp2A用引物,使用pbp2A592:gcgatgtatttgaataacgc / pbp2A1688:agcatcatactggtcatttc。 In addition, all expression analyzes were performed using 16S rRNA gene expression as a control, and primers (S-PT84-16S-f: accgacttcgggtgttacaa / S-PT84 -16S-r: cgcctacatgaagtcggaat).

[0107] expression inducing condition

[0108] Differences in temperature: After culturing lactic a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed is a process for producing a lactic acid bacterium having an enhanced immunomodulating activity. A lactic acid bacterium is cultured at a higher temperature than a recommended culture temperature for the lactic acid bacterium, thereby increasing the amount and thickness of the cell wall of the lactic acid bacterium. In this manner, a lactic acid bacterium having an immunomodulating activity that is enhanced in relation to the increase in the amount and thickness of the cell wall can be produced. In the process, any special culture medium or any special step is not required. The process enables the enhancement of the immunomodulating function of a lactic acid bacterium. Therefore, the process can produce a lactic acid bacterium capable of exerting an excellent immunomodulating activity in human bodies, or a food or beverage, a pharmaceutical preparation, a cosmetic preparation or the like that contains the lactic acid bacterium.

Description

technical field [0001] The present invention relates to a method for producing lactic acid bacteria with enhanced immune regulation. More specifically, it relates to a method for producing lactic acid bacteria having enhanced immunomodulatory effects such as immunostimulatory effects and antiallergic effects by increasing the cell wall of lactic acid bacteria, that is, an immunomodulatory component. Background technique [0002] In recent years, infectious diseases caused by decreased immunity due to aging have increased. It is well known that the hectic modern society and life in a stressful environment can also lead to a decline in immunity, and the countermeasures are highly anticipated. In addition, recently, emerging infectious diseases such as bird flu and re-emerging infectious diseases such as tuberculosis are rampant. It is important for modern people who are worried about the decline of immunity to strengthen their immunity to protect the body against foreign enem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A23L1/30A61K8/99A61K35/74A61P37/04A61P43/00C12R1/225A61K35/747
CPCA61K35/747A23L33/135A61P37/04A61P43/00C12N1/20C12R2001/225Y10S435/853
Inventor 出云贵幸星子浩之前川敏宏
Owner SUNTORY HLDG LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More