Production of fatty acid esters

A technology of fatty acid ester and fatty acid ethyl ester, applied in the field of fatty acid ester, can solve problems such as oil leakage

Active Publication Date: 2012-05-16
GENOMATICA INC
View PDF10 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition to transportation costs, there are environmental risks of large oil spills

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production of fatty acid esters
  • Production of fatty acid esters
  • Production of fatty acid esters

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0358] Example 1. FAEE production without exogenous ethanol, multiple feeds of methanol

[0359] First, a modified Escherichia coli Δ4 strain (MG1655) carrying a plasmid containing 'tesA, fadD and atfA1 was constructed. Δfad E · Δfab R · Δpox B · ΔldhA).

[0360] 1. Construction of Δ4 strain:

[0361] Escherichia coli MG1655 (an Escherichia coli K strain) was introduced using the lambda red system (also known as red-driven integration) described in Datsenko et al., Proc. ), the fadE gene of ) was deleted, wherein the following changes were made to the system.

[0362] Use two primers to generate deletions:

[0363] Del-fad E-F

[0364] 5'-AAAAACAGCAACAATGTGAGCTTTGTTGTAATTATATTGTAAACATATTGATTCCGGGGATCCGTCGACC (SEQ ID NO: 1)

[0365] Del-fad E-R

[0366] 5'-AAACGGAGCCTTTCGGCTCCGTTATTCATTTACGCGGCTTCAACTTTCCTGTAGGCTGGAGCTGCTTC (SEQ ID...

Embodiment 2

[0922] Example 2. Production of FAEE in the absence of exogenous ethanol, with a single methanol feed

[0923] A modified E. coli Δ4 strain carrying a plasmid containing 'tesA, fadD and atfA1 (as described in Example 1) was grown in a fermentor under aerobic conditions favoring growth and fatty acid methyl ester production. Initially, cells were grown with excess glucose and excess oxygen. No accumulation of ethanol was observed. After induction, the culture is maintained with a glucose feed lower than that consumed so that glucose does not accumulate. The glucose feed rate was faster than in Example 1. Methanol was added only once at a concentration of about 10 g / L. In the early stages of fermentation, the results were similar to Example 1, 78% FAME and 22% FAEE. However, late in the run, glucose consumption decreased, glucose accumulated in the fermenter, and methanol concentration dropped to about 5 g / L. At this point, the culture had almost stopped producing FAMEs and...

Embodiment 3

[0924] Example 3. Production of FAEE in the absence of supply of exogenous alcohol

[0925] Escherichia coli strain ID1 (MG1655ΔfadE constructed according to Example 1, which has an operon containing the genes 'tesA, fadD and atfA1 integrated in the chromosome and controlled by the Trc promoter) under conditions favorable for growth and free fatty acid production grown in fermenters.

[0926] Initially, the cells were grown with an excess of glucose (5 g / L) and given an exponential glucose and mineral feed to the cells, allowing the cells to -1 growth at a rate of ; following this feeding, a fixed feeding regimen was given. Throughout the run, maintain the cultures fully aerobic. No exogenous alcohol was added to the medium. A small amount of ethanol was produced and a large amount of free fatty acids was produced. The engineered fatty acid pathway includes ester synthase, the main enzyme responsible for the production of esters in the presence of added alcohol. In this cas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Methods of producing fatty acid esters, such as fatty acid ethyl esters, from microorganisms genetically engineered to alter the expression of genes involved in fatty acid synthesis and / or ethanol production, such that a microorganism is obtained that can produce an alcohol, a fatty acid and an ester synthase in the absence of exogenously added alcohols.

Description

[0001] Cross References to Related Applications [0002] This application claims the benefit of U.S. Provisional Application No. 61 / 173,016, filed April 27, 2009, and U.S. Provisional Application No. 61 / 182,564, filed May 29, 2009, which are hereby incorporated by reference in their entirety . technical field [0003] The present disclosure generally relates to methods of using genetically engineered cells and microorganisms to produce fatty acid esters and the fatty acid esters produced by these methods. The products are especially useful as biofuels. Background of the invention [0004] Petroleum is a finite natural resource found on earth, in liquid, gaseous or solid form. Petroleum is mainly composed of hydrocarbons, which are mainly composed of carbon and hydrogen. Petroleum also contains large quantities of other elements in different forms, such as nitrogen, oxygen or sulfur. [0005] Petroleum is a valuable resource, but exploitation of petroleum products comes a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P7/64C12P7/649
CPCC12P7/649Y02E50/17C12P7/065Y02E50/13C12N9/1029C12N9/52C12N9/16C12N9/0006C12N9/0008Y02P30/20Y02E50/10
Inventor费尔南多·桑切斯-瑞拉斯蒂芬·B·德尔卡德耶费尔南多·瓦勒
OwnerGENOMATICA INC