Reagent kit for noninvasive test of cervical cancer susceptibility gene
A detection kit and susceptibility gene technology, applied in the field of molecular biology, can solve problems such as abnormal expression of oncogenes and tumor suppressor genes, regulation of cell growth and function, abnormal DNA methylation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1. Use of detection kit
[0022] 1. Extract DNA template
[0023] Scrape the epithelial cells of the oral mucosa of the subject, and extract the genomic DNA by phenol-chloroform method.
[0024] 2. PCR amplification reaction
[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0026] (1) P53 (Arg72Pro) forward primer: 5'CGTTCTGGTAAGGACAAGGGTT3'P53 (Arg72Pro) reverse primer: 5'AAGAAGCCCAGACGGAAACC3'
[0027] (2) GSTM1 (Null / Present) forward primer: 5'GAACTCCCTGAAAAGCTAAAGC 3'GSTM1 (Null / Present) reverse primer: 5'GTTGGGCTCAAATATACGGTGG3'
[0028] (3) GSTT1 (Null / Present) forward primer: 5'TTCCTTACTGGTCCTCACATCTC3'GSTT1 (Null / Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'
[0029] (4) MTHFR (C677T) forward primer: 5'CATCCCTCGCCTTGAACAG3'MTHFR (C677T) reverse primer: 5'CAGACACTGTTGCTGGGTTTT3'
[0030] The PCR amplification reaction system is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, ...
Embodiment 2
[0046] Example 2. The service of non-invasive genetic testing for people to prevent the onset of cervical cancer
[0047] 1. Sampling and extraction of DNA
[0048] Instructed by hospital laboratory physicians to use oral sampling swabs for oral epithelial cell sampling, and phenol-chloroform method for oral epithelial cell DNA extraction
[0049] 2. Genotyping
[0050] Using the kit provided by the present invention, Arg72Pro (rs1042522) on the P53 gene of the subject's genomic DNA, whether GSTM1 gene is missing (Null / Present), whether GSTT1 gene is missing (Null / Present), and C677T (rs1801133) on the MTHFR gene DNA sequencing was performed on the 4 SNPs sites to determine the genotypes of these 4 SNPs sites.
[0051] 3. Risk assessment of high-risk groups of cervical cancer
[0052] Through the analysis of the SNPs genotypes of the subjects, a report on the risk assessment of cervical cancer susceptibility genes is issued. The report details the Arg72Pro (rs1042522) on the P53 gene o...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap