Check patentability & draft patents in minutes with Patsnap Eureka AI!

Reagent kit for noninvasive test of cervical cancer susceptibility gene

A detection kit and susceptibility gene technology, applied in the field of molecular biology, can solve problems such as abnormal expression of oncogenes and tumor suppressor genes, regulation of cell growth and function, abnormal DNA methylation, etc.

Inactive Publication Date: 2012-06-27
解码(上海)生物医药科技有限公司
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

MTHFR is the core enzyme of folic acid activation in the process of folic acid metabolism. Studies have found that the C677T polymorphic site mutation on the MTHFR gene can lead to a decrease in the thermostability and enzyme activity of the enzyme, thereby causing abnormal DNA methylation. Abnormal kylation may lead to abnormal expression of oncogenes and tumor suppressor genes, affect the regulation of cell growth and function, and promote the occurrence of cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit for noninvasive test of cervical cancer susceptibility gene
  • Reagent kit for noninvasive test of cervical cancer susceptibility gene
  • Reagent kit for noninvasive test of cervical cancer susceptibility gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Use of detection kit

[0022] 1. Extract DNA template

[0023] Scrape the epithelial cells of the oral mucosa of the subject, and extract the genomic DNA by phenol-chloroform method.

[0024] 2. PCR amplification reaction

[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0026] (1) P53 (Arg72Pro) forward primer: 5'CGTTCTGGTAAGGACAAGGGTT3'P53 (Arg72Pro) reverse primer: 5'AAGAAGCCCAGACGGAAACC3'

[0027] (2) GSTM1 (Null / Present) forward primer: 5'GAACTCCCTGAAAAGCTAAAGC 3'GSTM1 (Null / Present) reverse primer: 5'GTTGGGCTCAAATATACGGTGG3'

[0028] (3) GSTT1 (Null / Present) forward primer: 5'TTCCTTACTGGTCCTCACATCTC3'GSTT1 (Null / Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'

[0029] (4) MTHFR (C677T) forward primer: 5'CATCCCTCGCCTTGAACAG3'MTHFR (C677T) reverse primer: 5'CAGACACTGTTGCTGGGTTTT3'

[0030] The PCR amplification reaction system is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, ...

Embodiment 2

[0046] Example 2. The service of non-invasive genetic testing for people to prevent the onset of cervical cancer

[0047] 1. Sampling and extraction of DNA

[0048] Instructed by hospital laboratory physicians to use oral sampling swabs for oral epithelial cell sampling, and phenol-chloroform method for oral epithelial cell DNA extraction

[0049] 2. Genotyping

[0050] Using the kit provided by the present invention, Arg72Pro (rs1042522) on the P53 gene of the subject's genomic DNA, whether GSTM1 gene is missing (Null / Present), whether GSTT1 gene is missing (Null / Present), and C677T (rs1801133) on the MTHFR gene DNA sequencing was performed on the 4 SNPs sites to determine the genotypes of these 4 SNPs sites.

[0051] 3. Risk assessment of high-risk groups of cervical cancer

[0052] Through the analysis of the SNPs genotypes of the subjects, a report on the risk assessment of cervical cancer susceptibility genes is issued. The report details the Arg72Pro (rs1042522) on the P53 gene o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a reagent kit for noninvasive test of cervical cancer susceptibility gene, which comprises specific primers, DNA (deoxyribonucleic acid) sequencing primers, PCR(polymerase chain reaction) reaction components, PCR product purifying components, DNA sequencing reaction components and the like, wherein the specific primers and the DNA sequencing primers are used for testing four mononucleotide polymorphism locus genotypes of Arg72Pro(rs1042522) on gene P53, deletion of gene GSTM1 (null / present), deletion of gene GSTT1 gene (null / present) and C677T(rs1801133) on gene MTHFR. The reagent kit can be used evaluating the risk level of female cervical cancer proportion by testing the four mononucleotide polymorphism locus genotypes relative to generation of cervical cancer closely, so that women can be guided to prevent cervical cancer pointedly in terms of the gene according to the gene test result of each woman to be tested, and the proportion of cervical cancer can be reduced. The reagent kit can be used with the oral mucosa cell sampling which is painless and non-invasive, so that cross infection is avoided. In addition, the sequencing test results are accurate and reliable, purchasing of expensive import special instruments is omitted, and the reagent kit is easy to be applied and popularized.

Description

Technical field [0001] The invention belongs to the field of molecular biology, and relates to medicine and biotechnology, and specifically relates to a cervical cancer susceptibility gene detection kit, which evaluates the risk level of cervical cancer from the genetic level according to the test results, and serves as a direction for the prevention and treatment of cervical cancer guide. Background technique [0002] Cervical cancer is one of the common gynecological malignancies. Its incidence ranks second among female malignancies, and its mortality rate gradually rises to the first place. According to statistics from the World Health Organization (WHO), it is estimated that there are about 466,000 new cases of cervical cancer each year, and 80% of these cases occur in developing countries. my country has about 140,000 new cases each year, accounting for 1 / 3 of the total number of new cases of cervical cancer in the world, and the incidence rate is 6 times that of some devel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More