Antigen epitope for preventing and treating trichinosis, composition thereof and application thereof

A technology of antigenic epitope and composition, applied in the field of immunobiology, can solve the problem of in-depth research on Trichinella paramyosin

Inactive Publication Date: 2012-07-11
CAPITAL UNIVERSITY OF MEDICAL SCIENCES
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the research on the antigenic epitope of Trichinella spiralis paramyosin is still not in-depth

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen epitope for preventing and treating trichinosis, composition thereof and application thereof
  • Antigen epitope for preventing and treating trichinosis, composition thereof and application thereof
  • Antigen epitope for preventing and treating trichinosis, composition thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment 1: Preparation of rTs-Pmy-N1-322aa protein

[0056] As shown in the sequence of steps 1-6 below.

[0057] 1. Amplification of the Ts-Pmy-N1-322aa gene fragment

[0058]According to the reading frame sequence of paramyosin gene (Ts-Pmy GenBank accession No.: EF429310), the nucleotide sequence of Ts-Pmy-N1-322aa can be obtained as follows:

[0059] ATGTCTCTGTATCGCAGTCCCAGTGCGTCAGTGATGAGATCAGCAAGCATGCTCAGCCGAAGTGGCGGATTCGATGCTTACGGATTTGGAGGTTACGGTGCGCCAAGCCTCAACGTTGCCGACTTGGGTTCTTTGACCAGACTCGAGGATAAAATTCGCCTGCTTCAAGATGATTTGGAAACGGAAAGAGAATTGCGAAACCGAATTGAACGCGAACGTGCCGATTTGTCCTGCCAACTGATCAGCTTAACCGATCGATTGGAAGAGGCTGAAGGAACCACCGATGCCCAGATCGACGCCAATCGAAAGCGTGAATCCGAATTGCAAAAGTTGAGAAAAATATTGGAAGATTCGCAATTGGAAAGCGAAGATTCGCTGAACCAGCTGCGCAAGAAGCACCAAGAATCCCTTTTAGATTATCAGCAGCAAATTGAACAACTTCAAAAGAAAAATAGCAAAATCGACAGAGAACGACAACGTTTGCAGCATGAAGTCATTGAACTTACTGCCGGAATTGATCAGATGCAAAAAGACAAGCATGCCGCGGAAAAAGCTGCCGAAAAGCACGAAGCGCATGCCAGAGAGCTTCAGAACAGAGTTGACGATCTGGCAAAAAATTTGA...

Embodiment 2

[0118] Embodiment 2: the establishment of hybridoma cell line

[0119] The rTs-Pmy-N1-322aa protein (solution) prepared in Example 1 was used to immunize BALB / c mice. After 4 times of immunization, the mouse antibody titer reached 1:128000 after the last immunization. Splenocytes from immunized mice were fused with SP2 / 0 myeloma cells in logarithmic growth phase, and cultured in HAT medium. In the 96-well culture plate, the growth of fusion cells can be seen. When the cell colony grows to 1 / 3 well, it is identified by indirect ELISA and Western blot, and the anti-rTs-Pmy-N1-322aa antibody is selected in the culture supernatant. It is also a positive hybridoma cell line that can recognize rTs-Pmy-N1-322aa and larva protein. After 3 times of subcloning, a hybridoma cell line was screened and named 8F12. The antibody secreted by it belonged to IgG1 subclass antibody secreting Th2 type. After continuous subculture for 20 generations, F5, F10, F15 and F20 were selected respectiv...

Embodiment 3

[0123] Embodiment 3: Identification of the monoclonal antibody (mAb) secreted by 8F12 cell line

[0124] The titers of mAb in the cell culture supernatant and ascitic fluid of the 8F12 cell line in Example 2 detected by ELISA were 1:3200 and 1:64000, respectively. The secreted antibody subclasses were all IgG1 subclass κ type (Table 3). The monoclonal antibody ascites was purified by HiTrap rProtein A column and then subjected to SDS-PAGE electrophoresis. Bands appeared at 50kDa and 25kDa respectively, which corresponded to the position of IgG antibody heavy chain and light chain ( figure 1 ).

[0125] Table 3: Identification of monoclonal antibody 8F12

[0126]

[0127] In order to clarify the relative affinity of the mAb when it binds to the antigen at a certain antigen concentration, an indirect non-competition ELISA method was used. The logarithmic value of the dilution factor is 1g (C 0 / C) is the abscissa (C 0 is the initial concentration of mAb, and C is the c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of immunobiology, and relates to antigen epitope for preventing and treating trichinosis, a composition thereof and application thereof. According to the antigen epitope, an amino acid sequence is shown as any one of SEQ ID NO: 1-4. The antigen epitope has the effective trichina reduction rate and has the potential of being used as medicines (such as vaccines) for preventing and treating trichinization or diseases caused by the trichinization.

Description

technical field [0001] The invention belongs to the field of immunobiology, and relates to an antigenic epitope for preventing and treating trichinosis, its composition and application. Background technique [0002] Trichinellosis is a zoonotic parasitic disease with global distribution. Human infection mainly comes from highly pathogenic Trichinella spp. infections in animals and humans. [J]. Vet Parasitol, 2007, 149(1-2): 3-21. ). Due to the complex clinical symptoms of trichinellosis, including diarrhea, fever, myalgia, edema, etc., it is difficult to diagnose correctly, which makes timely drug treatment difficult and drug treatment cannot solve the problem of repeated infection of the worm (Gottstein B, Pozio E, Nockler K. Epidemiology, diagnosis, treatment, and control of trichinellosis. [J]. Clin Microbiol Rev, 2009, 22(1): 127-145.). The prevalence of trichinellosis not only directly threatens human health, but also causes major economic losses to animal husbandry,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/08C12N15/12C07K14/435C12N15/63C12N1/21C12N1/19C07K19/00A61K39/00A61P33/10C07K16/18A61K39/395
CPCA61K38/10A61K39/00A61K2039/505C07K14/4354C07K16/18C07K19/00
Inventor诸欣平顾园魏骏飞杨静李强
OwnerCAPITAL UNIVERSITY OF MEDICAL SCIENCES