Gene for controlling rice fertility, encoded protein and application thereof

A fertility gene, rice technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of low efficiency, no ABCG15, single population genetic type and trait expression, etc., to achieve labor saving, effective methods, and expansion. germplasm-based effects

Active Publication Date: 2012-08-15
SICHUAN AGRI UNIV
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The main problems of rice recurrent selective breeding using existing rice recessive male sterility are: (1) The overall character of the population is greatly affected by the genetic background of the recessive male sterile gene donor material, which may easily lead to the genetic The types and traits are single, and it is difficult to breed excellent strains; (2) The selection or elimination of strains with recessive sterility genes is based on the natural separation of offspring, which is time-consuming, heavy workload, and low efficiency
Trends in Plant Science 2008.13(14): 151-159), after searching, no report about the use of ABCG15 in rice male sterility was found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for controlling rice fertility, encoded protein and application thereof
  • Gene for controlling rice fertility, encoded protein and application thereof
  • Gene for controlling rice fertility, encoded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1 The fine mapping of the single recessive nuclear sterile gene of the present invention

[0058] (1) Using two sequenced parents 9311 and Nipponbare with large genetic differences 2 S hybridization to construct the positioning population.

[0059] (2) Using H 2 SSR primers and Indel (insertion-deletion) markers with polymorphism between S and 9311 and Nipponbare, in H 2 S×9311 combination F 2 Among the 1200 recessive sterile individual plants, and H 2 S×Nippon Clear F 2 Among the 1320 recessive sterile plants, the linkage relationship between the polymorphic markers Indel40520 and RM20366 between the parents and the sterility gene was analyzed.

[0060] (3) The gene controlling the male sterility is positioned at the 45K distance between Indel40520 and RM20366 (see figure 1 ). Indel40520 labeled primer sequence is:

[0061] Indel40520F: TTGGTCCCACAAATAAGTCATG (SEQ ID No: 6),

[0062] Indel40520R: TTGGAGCAACTGAAGCAAGGAA (SEQ ID No: 7);

[0063] The ...

Embodiment 2

[0064] Embodiment 2 Cloning and Identification of Rice Single Recessive Genic Male Sterility Gene of the Present Invention

[0065] According to the gene mapping results in Example 1, the Loc_OS06g40550 gene was used as a candidate gene for sequencing analysis. with H 2 S genome DNA is used as a template, and CDS40550-F and CDS40550-R are used as primers for PCR amplification, and the sequencing primers are:

[0066] CDS40550-F: CACCATGATGGAGATCAGCAGCAAT (SEQ ID No: 8),

[0067] CDS40550-R: CTACAAGGGCATGAGGCTGAT (SEQ ID No: 9);

[0068] Described PCR reaction system is: H 2 S genomic DNA 3μL (200ng), dNTP (2mM) 5μL, 10XPCR buffer 5μL, 25mM Mg 2+ 2 μL, primer 10 μM 1.5 μL; KOD-plus-NEO enzyme (1U / μL) 1.5 μL; DMSO 1.5 μL (provided by TOYOBO); H 2 O 30.5 μL. The reaction conditions of the PCR are: 94°C for 2min; 98°C for 10s, 68°C for 1:30min, 35 cycles; 68°C for 10min, 10°C for 1min. Recover the PCR product (refer to the Omega recovery kit manual for the method), and conn...

Embodiment 3

[0073] Example 3 Complementary transgene verification test

[0074] Proceed as follows:

[0075] 1 Construction of complementary expression vectors:

[0076]In order to verify whether the H2S male sterile material is caused by the 12bp deletion in ABCG15, a complementary transgene verification experiment was carried out. The construction method of the complementary expression vector is as follows:

[0077] 1.1 Take the normal fertile wild type (H 2 SW) The genomic DNA extracted from plant leaves is used as a template, and PCR amplification is carried out with Q51 and Q52 as primers; the primers are:

[0078] Q51: CCGGAATTCTGAATCGTCGTCACCTGCTAAGCCCAAAT (SEQ ID No: 12),

[0079] Q52: CGGGGTACCGTGTCCCTCCCTACCCAACCTAACCCAAC (SEQ ID No: 13);

[0080] The PCR reaction system is: Genomic DNA 3μL (200ng), dNTP (2mM) 5μL, 10xPCR buffer 5μL, 25mM Mg 2+ 2 μL, primer 10 μM 1.5 μL; KOD-plus-NEO (1U / μL) 1.5 μL; DMSO 1.5 μL (provided by TOYOBO); H 2 O 30.5 μL. The reaction conditions...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene ABCG15 for controlling rice fertility, an encoded protein and the application thereof. The invention also discloses a single recessive nuclear sterile gene, which is generated by mutation caused by deletion of the gene 12bp for controlling the rice fertility. The invention also discloses a method for obtaining a rice sterile line by controlling the expression of the rice fertility gene according to an RNAi technology and the method comprises the following steps of: amplifying a DNA fragment for generating an anti-sense RNA, constructing an expression vector, and transforming the DNA fragment into the normal fertile rice, so as to obtain a new rice nuclear sterile material. The newly found gene for controlling the rice fertility provides a new way for culturing the rice nuclear sterile line. The method for generating the rice nuclear sterile line is convenient and quick. The rice nuclear sterile material can be used for replacing the manual castration during the rice hybridization, labor is saved; the rice nuclear sterile material also can be used for recurrent selective breeding and plays an important role in widening the rice germ plasm basis.

Description

technical field [0001] The invention belongs to the field of plant fertility genes. It specifically relates to a gene and its encoded protein for controlling the fertility of rice; and a single recessive nuclear sterility gene produced by mutation of the gene; in addition, it also involves the use of RNAi technology to control the expression of the rice fertility gene to obtain rice fertility Breeding method Background technique [0002] Rice is a self-pollinated crop. For a long time, the improvement of rice varieties has mainly relied on hybrid breeding methods. However, due to the limitations of artificial castration and hybridization techniques, usually only a small number of parents can be used for hybridization. Difficult to breed breakthrough breeds. The main agronomic traits of rice are mostly quantitative traits controlled by micro-effect multi-genes. Recurrent selection breeding method can break the linkage of unfavorable genes and increase the accumulation of go...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/63C12N1/21A01H5/00C12N15/84C12N15/11C12Q1/68
Inventor李仕贵钦鹏王玉平涂兵马炳田邓路长
OwnerSICHUAN AGRI UNIV