Long genome segment deletion system and use thereof

A gene and fragment technology, applied in the direction of recombinant DNA technology, hydrolytic enzymes, etc., can solve the problems of poor robustness and economic traits, difficulty breaking through the limitation of variety resources, and single genetic background, and achieve accurate genetic transformation, high genetic transformation efficiency, The effect of enriching genetic resources

Active Publication Date: 2014-01-15
SOUTHWEST UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Major breakthroughs have not been made in the problems of silkworm varieties such as robustness, silk quality, yield and other main economic traits, and the inherent defects of silk clothing such as easy yellowing and wrinkling have not been fundamentally resolved.
The update of variety resources is far behind the production needs, and the overall production efficiency of the silk industry is low
This is mainly because: 1) After hundreds of years of excavation, the potential of increasing production based on traditional breeding methods has been maximized. In addition to the particularity and limitations of natural conditions, it is difficult to break through the limitations of the variety resources themselves.
Although there are many types and quantities of silkworm species in existence, their genetic background is single, and there is no significant difference in their economic and biological traits.
After a hundred years of change of silkworm breeds, there is no significant improvement in economic and biological traits
2) As a textile fiber, silk is so expensive that many consumers are discouraged. In addition, silk is prone to yellowing and wrinkling, so it does not occupy a large market share in various textile fibers.
3) For a long time, the main purpose of human domestication and breeding of silkworms is to reel and weave silk, so the existing silkworm varieties are almost all the same multi-filament varieties, and the composition and characteristics of their cocoons are basically the same
Although the currently widely used molecular improvement tools such as transgenic and RNAi have been well applied in silkworms, there have been no reports of technologies that can directly edit and transform endogenous genes in silkworms, let alone deletion of long-segment genome sequences. Related reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long genome segment deletion system and use thereof
  • Long genome segment deletion system and use thereof
  • Long genome segment deletion system and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1. Silkworm oil silkworm gene BmBlos2 Sequence analysis

[0026] Download silkworm oil silkworm gene from silkDB database BmBlos2 The sequence (numbered BGIBMGA002101). Sequence analysis showed that the gene includes four exons of 180 bp, 131 bp, 112 bp and 608 bp and three introns of 2465 bp, 663 bp and 2703 bp. The first exon includes a 125 bp untranslated region and 55bp coding region, its structure is as figure 1 Shown. According to the general principle of gene knockout, the second and third exons of the gene are ideal target sites. In this embodiment, the second and third exons are the target sites.

Embodiment 2

[0027] Example 2. The third exon nuclease TALEN -B3 the design of

[0028] According to Bombyx mori gene BmBlos2 The sequence characteristics of the third exon, we chose the sequence on the third exon as the target sequence of the transcription activator-like effector nuclease TALEN-B3, the silkworm oil silkworm gene BmBlos2 The nucleotide sequence of the third exon is shown in SEQ ID NO. 1. According to the TALEN principle, the nucleotide sequence of the structure T(Nn)A is the target sequence recognized by the transcription activator-like effector nuclease TALEN, where N It is any base of A, G, T and C, and n is any number between 24 and 65. According to the above principles, the target site recognized by TALEN is designed to be 5’- tcaccaagtacgcagatcta aggagcctagccgc g aacctgaacaagaccctta -3'(SEQ ID NO.2), the underlined part is the recognition module of the transcriptional activator-like effector nuclease TALEN-B3, the bold part represents the spacer sequence, and the u...

Embodiment 3

[0030] Example 3. Design of the second exon nuclease TALEN-B2

[0031] According to Bombyx mori gene BmBlos2 The sequence characteristics of the second exon were selected as the target sequence of TALEN-B2, the silkworm oil silkworm gene BmBlos2 The nucleotide sequence of the second exon is shown in SEQ ID NO.5. According to the TALEN principle, the nucleotide sequence of the structure T(Nn)A is the target sequence of TALEN, where N is A, G, T and C In any base, n is any number between 24 and 65. According to the above principle, the target sequence designed for TALEN is 5’- tggatccacatgatcctgt gatcagtcggttagcc acacagctctttaaaaaaa -3'(SEQ ID NO.6), the underlined part is the TALE recognition module, the bold part represents the spacer sequence, and the underlined nucleotide sequence at the 5'end is the 5'end recognition module, corresponding to SEQ ID NO.2 Nucleotides 1-19 of the 3'end of the nucleotide sequence is the 3'end recognition module, corresponding to the 36-54 sh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a long genome segment deletion system. The long genome segment deletion system comprises two transcription activator-type effector TALENs of two target sequences of a specific splicing gene and is used for long genome segment deletion of a target gene after gene combination. The invention also discloses a use of the long genome segment deletion system. The long genome segment deletion system is convenient for use, is used for breeding of species producing large hereditary variation, provides rich genetic resources for breeding and has wide application prospects.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a genome long fragment deletion system, and also relates to the application of the genome long fragment deletion system. Background technique [0002] Bombyx mori is an important economic insect and a model organism of Lepidoptera. It has been bred and domesticated for more than 5,000 years in my country. The silk industry has always been in harmony with agriculture in history, and has made great contributions to the development of the Chinese nation's economy and the promotion of culture. Silk has inherent excellent characteristics such as graceful and elegant luster, light and comfortable touch, good drapability and curve of clothing materials, moderate water absorption and affinity to human skin, etc., and has been loved by consumers for a long time. Silk is also known as the "fiber queen" for this reason. At present, the total annual output value of my country's silk industry h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/22C12N15/09
Inventor夏庆友马三垣刘园园徐汉福林英
OwnerSOUTHWEST UNIV