Polypeptide for effectively inhibiting activity of influenza virus polymerase
An influenza virus, polymerase technology, applied in the direction of viral peptides, medical preparations containing active ingredients, antiviral agents, etc., can solve the problems of resistant viruses, emergence, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Embodiment 1, Fragment PB1 731-757 s Choice
[0018] According to the crystal structures of PB1c and PB2n (PDB ID 2ZTT) (18), it can be seen that the third α-helix of PB1c is very close to the second α-helix of PB1c and PB2n, and the side chains of many residues have direct interactions . Whether the third α-helix of PB1c can directly participate in the interaction with PB1c or PB2n has not been mentioned in the existing literature, and it is not clear what function this region has in the assembly of PB1c and PB2n. We think that the third α-helix of PB1c may interact with the second α-helix of PB1c or PB2n. Therefore, we choose the third α-helix on PB1c (PB1 736-755 ) and extended 5 and 2 amino acids at the N-terminal and C-terminal respectively to maintain the stability of the α-helical structure, that is, PB1 731-757 As a detection object, it is to see whether the fragment can interact with PB1c or PB2n, and whether it can inhibit the activity of influenza virus p...
Embodiment 2
[0019] Embodiment 2, detect PB1 731-757 Interaction with PB1c or PB2n
[0020] Detection of PB1 by BiFc (bimolecular fluorescence complementation assay) method 731-757 Interaction with PB1c or PB2n.
[0021] The principle of BiFc is: cut the fluorescent protein at some specific sites to form two non-fluorescent N- and C-terminal polypeptides, called N-fragment (N-fragment) and C-fragment (C-fragment). When these two fragments are co-expressed in cells or mixed in vitro, they cannot spontaneously assemble into a complete fluorescent protein, and cannot produce fluorescence when excited by the excitation light of the fluorescent protein. However, when the fragments of these two fluorescent proteins are respectively linked to a group of interacting target proteins, and the two fusion proteins are co-expressed in cells or mixed in vitro, due to the interaction of the target proteins, the two fluorescent proteins The fragments are spatially close to each other and complement eac...
Embodiment 3
[0030] Embodiment 3, polypeptide fragment PB1 731-757 Cloned into the eukaryotic expression vector pFA-Flag-GFP vector
[0031] The NdeI restriction site in the vector pcDNA3.1-6HA (8) was mutated by site-directed mutagenesis, and the primers were NdeI-F: CATCAAGTGTATCGTATGCCAAGTAC; NdeI-R: CGTACTTGGCATACGATACACTTGATG. After the sequence is correct, it will be denoted as pcDNA3.1-6HA-M, and the designed primer: Flag-F: CCCAAGCTT CATATG GACTACAAAGACGATGACGACAAG GGATCC GTGAGCAAGGGCGAGGAG; Flag-R: CCGGAATTCCCCGGGACTACTTGTACAGCTCGTCCATGC, Flag-GFP was amplified from the template pEGFP-N1 (purchased from clontech), and the obtained PCR product was digested with HindIII and EcoRI (produced by Takara Company), and the digested product was recovered. The digested product was connected to the vector pcDNA3.1-6HA-M which was digested and recovered with HindIII and EcoRI (manufactured by Takara Company), to obtain pFA-Flag-GFP, wherein there were NdeI and BamHI restriction sites on b...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More