Pteromalus puparum venom Kazal serine proteinase inhibitor polypeptide and its application

A technology of serine protease and golden bee, applied in the direction of protease inhibitors, applications, animal/human peptides, etc.

Active Publication Date: 2012-10-17
ZHEJIANG UNIV
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, with the continuous planting of insect-resistant Bt crops with only a single Bt gene, the problem of target pest resistance to it has also attracted increasing attention, and signs of resistance have appeared in the American bollworm in Bt cotton fields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pteromalus puparum venom Kazal serine proteinase inhibitor polypeptide and its application
  • Pteromalus puparum venom Kazal serine proteinase inhibitor polypeptide and its application
  • Pteromalus puparum venom Kazal serine proteinase inhibitor polypeptide and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] 1. PpKazal gene cloning of the Kazal-like serine protease inhibitor PpKazal from the chrysalis golden bee venom:

[0078] A pair of primers (forward primer Kaz-SP: 5'-CATGGCATTTGGATGTGAAG-3', reverse primer Kaz-AP: 5') were designed according to the partial sequence of the Kazal serine protease inhibitor gene obtained from the venom gland transcriptome data of Chrysalis chrysalis -TCTGTTCCATTCTCGGCCTT-3') Use the cDNA of the venom gland of Chrysalis chrysalis as a template to amplify by PCR to verify the transcriptome results, and a PCR fragment of about 200 bp was obtained by PCR. The PCR amplification system and amplification conditions are as follows:

[0079] The PCR amplification system is:

[0080]

[0081]

[0082] The amplification conditions are:

[0083]

[0084] PCR amplified products were separated by 1% agarose gel electrophoresis, purified by AxyAprep DNA gel recovery kit, ligated into pGEM?-T-easy vector (Promega) by TA cloning method, and posi...

Embodiment 2

[0135] 1. Construction of PpKazal gene plant binary expression vector

[0136] The cauliflower mosaic virus CaMV 35S promoter and NOS terminator on both sides of the GUS gene in the plant binary expression vector pBI121 were used to insert the PpKazal gene to form a complete expression framework. In this experiment, BamHI and SacI were selected as restriction sites to replace the GUS gene with PpKazal, so that the expression cassettes on both sides of the GUS gene were used to control the expression of the PpKazal gene in Arabidopsis plants.

[0137] Primers with BamHI and SacⅠ restriction sites were designed according to the ORF of the serine protease inhibitor of the venom of A. chrysalis, and the plant expression vector was constructed by PCR amplification using the cDNA of the venom gland of A. chrysalis as a template. The primer sequences are:

[0138] PpKazal-SP:TCG GGATCC TGTGAAGAAGAACAATGTCAAAAAA,

[0139] PpKazal-AP: CGC CTAACATTCCTCGTACTTGACAA,

[0140] in, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Pteromalus puparum venom Kazal serine proteinase inhibitor polypeptide which has an amino acid sequence represented by SEQ ID NO:2. The invention simultaneously discloses gene coding the Pteromalus puparum venom Kazal serine proteinase inhibitor polypeptide, wherein the gene has a nucleotide sequence represented by a 145-297 nucleotide sequence in SEQ ID NO:1, or has a nucleotide sequence having at least 70% homology with the 145-297 nucleotide sequence in the SEQ ID NO:1, or has a nucleotide sequence which can be hybridized with the 145-297 nucleotide sequence in the SEQ ID NO:1 at 40-55DEG C. The polypeptide of the invention is used for preparing Pteromalus puparum venom Kazal serine proteinase inhibitors, and the inhibitors can be used for inhibiting the activation of Pieris rapae or Papilio xuthus hemolymph PPO (prophenoloxidase).

Description

technical field [0001] The invention relates to the fields of molecular biology, genetic engineering and protein engineering. In particular, a Kazal-like serine protease inhibitor protein expressed in the chrysalis chrysalis venom and its encoded nucleic acid sequence and application. Background technique [0002] Pests have always been a serious threat to the safe production of global crops, causing about a quarter of global food production to be reduced every year, resulting in huge economic losses. In my country, agricultural pests have always been an important factor restricting the increase in agricultural production and the improvement of the quality of agricultural products. According to statistics, the annual area of ​​pests and diseases in the country has increased from 5 billion mu per time in 2000 to 7 billion mu per time in 2009. The annual grain loss recovered through the prevention and control of diseases and insect pests accounts for about 15%-20% of the tota...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/81C12N15/15A01H5/00A01N47/44A01P7/04
Inventor叶恭银王磊方琦王飞
OwnerZHEJIANG UNIV