Unlock instant, AI-driven research and patent intelligence for your innovation.

Novel acetyl coa carboxylases

A technology of acetyl coenzyme and carboxylase, applied in the fields of enzymes, ligases, organic chemistry, etc., can solve problems such as changing lipid levels and increasing lipid production

Inactive Publication Date: 2012-10-17
SAPPHIRE ENERGY
View PDF28 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These efforts produced increased levels of ACCase protein in the target organism, but did not significantly alter lipid levels (e.g., as illustrated in Hu et al., The Plant J., 54:621 (2008) of)
[0018] In order to increase fatty acid synthesis in a cell, what is required is not simply to increase the production of ACCase protein, but rather to increase the level of ACCase activity in the cell, resulting in an increase in lipid production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel acetyl coa carboxylases
  • Novel acetyl coa carboxylases
  • Novel acetyl coa carboxylases

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0478] Example 1. Analysis of Chlamydomonas reinhardtii plastid β-ACC enzyme gene

[0479] The Chlamydomonas plastid β-ACC enzyme gene was examined (SEQ ID NO: 1; genbankEDO96563). Unless otherwise stated, all amino acid position numbers refer to SEQ ID NO:1.

[0480] Annotation of this gene indicated a chloroplast transit peptide as expected; the gene is present in the nuclear genome but is active in chloroplasts. The mature gene sequence was submitted to the Swiss-Model server to generate a homology model based on the crystal structure of the S. aureus ACCase β subunit (PDB structure 2F9I). From inspection of this structure, it is clear that residue 255 (cysteine ​​255) would cross the heterotetramer axis from another β subunit and could conceivably form a disulfide under oxidative conditions key. Another cysteine ​​residue would be expected to be buried within the protein, and possibly not under redox control. Finally, the four cysteine ​​residues are expected to form...

example 2

[0485] Example 2. Mutagenesis of the gene encoding the beta subunit of the wild-type Chlamydomonas reinhardtii ACCase

[0486] To determine whether mutation of one or more of the above residues to aspartic acid (or serine if the natural amino acid is cysteine) can generate the ACCase β subunit (which can associate with endogenous α and biotin domain proteins form a constitutively active complex), the open reading frame encoding the wild-type Chlamydomonas ACCase β subunit, codon-optimized for chloroplast expression, and the N-terminal Strept-tag epitope (ATGGGTTCTGCTTGGTCTCATCCAATTTGAAAAACAT; SEQ ID NO :25) was synthesized and cloned into the pSE-3HB-K-tD2 Chlamydomonas plastid expression vector (downstream of the D2 promoter) ( Figure 4 ). This vector was then transformed into both the 137c and 1690 background Chlamydomonas.

[0487] Seven pairs of oligonucleotides (SEQ ID NO: 40 to 53) encoding the proposed activating mutations (C255S, T134D, T141D, S143D, S151D, S155D,...

example 3

[0500] Example 3. Generation of multiple mutations in the gene encoding the beta subunit of the ACCase of Chlamydomonas reinhardtii

[0501] In addition to the seven single mutations made in the ACCase gene, several combinations of these seven single mutations were made in the ACCase gene. Specifically, S151D+S155D; S151D+S155D+Y337D; and S151D+S155D+C255S.

[0502] The forward and reverse primers used to generate the S151D+S155D double mutant are listed below. Nucleotides encoding mutated amino acids are underlined and in bold.

[0503] S151D / S155D-Forward ATCCTTTAGAATTT GACTTAAAAA TATACTGATCGTATT (SEQ ID NO: 54)

[0504] S151D / S155D - Reverse AATACGATCAGTAT CTTTTAAGT CAAATTCTAAAGGATC (SEQ ID NO: 55)

[0505] A triple mutant was made by using the PCR product of the double mutant (S151D+S155D) as template DNA and using the forward and reverse primers (SEQ ID NO: 52 and 53) listed above for the single mutant Y337D S151D+S155D+Y337D.

[0506] A triple mutant was m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

Provided herein are novel ACCases and nucleotides encoding the same, that when introduced into a cell or organism results in an increase and / or accumulation of fatty acids, glycerol lipids, and / or oils in the cell or organism, and / or a change in the types of fatty acids, glycerol lipids, and / or oils that are normally present in the cell or organism. Also provided herein are organisms transformed with the novel ACCases.

Description

[0001] Cross References to Related Applications [0002] This application claims the benefit of US Provisional Application No. 61 / 242,489, filed September 15, 2009, the entire contents of which are hereby incorporated by reference for all purposes. [0003] binding by reference [0004] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was individually and individually indicated to be incorporated by reference. Background of the invention [0005] Acetyl-CoA carboxylases (ACCases) are rate-limiting enzymes in the fatty acid biosynthetic pathway in plant, animal, yeast, and bacterial cells. Structurally, ACC enzymes are biotinylated and are larger enzymes composed of two or more subunits. For example, the cytoplasmic form in animals, plants, and most ACC enzymes of yeast are dimers of native MW of 420 to 700 kD and contain s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/52C07H21/04C12N1/21A01H1/00C12N1/15C12N15/82A01H5/00C12N1/19
CPCC12P7/6409C12N9/93C12N15/8247C12P19/32C12Y604/01002C12P7/6463
Inventor C·贝恩克D·莫利娜S·利伯曼J·巴赫S·吴
Owner SAPPHIRE ENERGY