Novel acetyl coa carboxylases
A technology of acetyl coenzyme and carboxylase, applied in the fields of enzymes, ligases, organic chemistry, etc., can solve problems such as changing lipid levels and increasing lipid production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0478] Example 1. Analysis of Chlamydomonas reinhardtii plastid β-ACC enzyme gene
[0479] The Chlamydomonas plastid β-ACC enzyme gene was examined (SEQ ID NO: 1; genbankEDO96563). Unless otherwise stated, all amino acid position numbers refer to SEQ ID NO:1.
[0480] Annotation of this gene indicated a chloroplast transit peptide as expected; the gene is present in the nuclear genome but is active in chloroplasts. The mature gene sequence was submitted to the Swiss-Model server to generate a homology model based on the crystal structure of the S. aureus ACCase β subunit (PDB structure 2F9I). From inspection of this structure, it is clear that residue 255 (cysteine 255) would cross the heterotetramer axis from another β subunit and could conceivably form a disulfide under oxidative conditions key. Another cysteine residue would be expected to be buried within the protein, and possibly not under redox control. Finally, the four cysteine residues are expected to form...
example 2
[0485] Example 2. Mutagenesis of the gene encoding the beta subunit of the wild-type Chlamydomonas reinhardtii ACCase
[0486] To determine whether mutation of one or more of the above residues to aspartic acid (or serine if the natural amino acid is cysteine) can generate the ACCase β subunit (which can associate with endogenous α and biotin domain proteins form a constitutively active complex), the open reading frame encoding the wild-type Chlamydomonas ACCase β subunit, codon-optimized for chloroplast expression, and the N-terminal Strept-tag epitope (ATGGGTTCTGCTTGGTCTCATCCAATTTGAAAAACAT; SEQ ID NO :25) was synthesized and cloned into the pSE-3HB-K-tD2 Chlamydomonas plastid expression vector (downstream of the D2 promoter) ( Figure 4 ). This vector was then transformed into both the 137c and 1690 background Chlamydomonas.
[0487] Seven pairs of oligonucleotides (SEQ ID NO: 40 to 53) encoding the proposed activating mutations (C255S, T134D, T141D, S143D, S151D, S155D,...
example 3
[0500] Example 3. Generation of multiple mutations in the gene encoding the beta subunit of the ACCase of Chlamydomonas reinhardtii
[0501] In addition to the seven single mutations made in the ACCase gene, several combinations of these seven single mutations were made in the ACCase gene. Specifically, S151D+S155D; S151D+S155D+Y337D; and S151D+S155D+C255S.
[0502] The forward and reverse primers used to generate the S151D+S155D double mutant are listed below. Nucleotides encoding mutated amino acids are underlined and in bold.
[0503] S151D / S155D-Forward ATCCTTTAGAATTT GACTTAAAAA TATACTGATCGTATT (SEQ ID NO: 54)
[0504] S151D / S155D - Reverse AATACGATCAGTAT CTTTTAAGT CAAATTCTAAAGGATC (SEQ ID NO: 55)
[0505] A triple mutant was made by using the PCR product of the double mutant (S151D+S155D) as template DNA and using the forward and reverse primers (SEQ ID NO: 52 and 53) listed above for the single mutant Y337D S151D+S155D+Y337D.
[0506] A triple mutant was m...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 